ID: 1075997520

View in Genome Browser
Species Human (GRCh38)
Location 10:126890617-126890639
Sequence CGCAACAGAACGGCAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997520_1075997529 2 Left 1075997520 10:126890617-126890639 CCCTTGCCTGCCGTTCTGTTGCG No data
Right 1075997529 10:126890642-126890664 AAGTCAGGGACCCCAAACGGAGG No data
1075997520_1075997534 20 Left 1075997520 10:126890617-126890639 CCCTTGCCTGCCGTTCTGTTGCG No data
Right 1075997534 10:126890660-126890682 GGAGGGACCAGCTGAAGCCATGG No data
1075997520_1075997528 -1 Left 1075997520 10:126890617-126890639 CCCTTGCCTGCCGTTCTGTTGCG No data
Right 1075997528 10:126890639-126890661 GGGAAGTCAGGGACCCCAAACGG No data
1075997520_1075997530 3 Left 1075997520 10:126890617-126890639 CCCTTGCCTGCCGTTCTGTTGCG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997520 Original CRISPR CGCAACAGAACGGCAGGCAA GGG (reversed) Intergenic