ID: 1075997521

View in Genome Browser
Species Human (GRCh38)
Location 10:126890618-126890640
Sequence CCGCAACAGAACGGCAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997521_1075997528 -2 Left 1075997521 10:126890618-126890640 CCTTGCCTGCCGTTCTGTTGCGG No data
Right 1075997528 10:126890639-126890661 GGGAAGTCAGGGACCCCAAACGG No data
1075997521_1075997530 2 Left 1075997521 10:126890618-126890640 CCTTGCCTGCCGTTCTGTTGCGG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997521_1075997529 1 Left 1075997521 10:126890618-126890640 CCTTGCCTGCCGTTCTGTTGCGG No data
Right 1075997529 10:126890642-126890664 AAGTCAGGGACCCCAAACGGAGG No data
1075997521_1075997534 19 Left 1075997521 10:126890618-126890640 CCTTGCCTGCCGTTCTGTTGCGG No data
Right 1075997534 10:126890660-126890682 GGAGGGACCAGCTGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997521 Original CRISPR CCGCAACAGAACGGCAGGCA AGG (reversed) Intergenic