ID: 1075997524

View in Genome Browser
Species Human (GRCh38)
Location 10:126890623-126890645
Sequence ACTTCCCGCAACAGAACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997524_1075997529 -4 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997529 10:126890642-126890664 AAGTCAGGGACCCCAAACGGAGG No data
1075997524_1075997536 27 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997536 10:126890673-126890695 GAAGCCATGGCAGAAGAACGTGG No data
1075997524_1075997534 14 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997534 10:126890660-126890682 GGAGGGACCAGCTGAAGCCATGG No data
1075997524_1075997530 -3 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997524_1075997528 -7 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997528 10:126890639-126890661 GGGAAGTCAGGGACCCCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997524 Original CRISPR ACTTCCCGCAACAGAACGGC AGG (reversed) Intergenic