ID: 1075997530

View in Genome Browser
Species Human (GRCh38)
Location 10:126890643-126890665
Sequence AGTCAGGGACCCCAAACGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997516_1075997530 13 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997520_1075997530 3 Left 1075997520 10:126890617-126890639 CCCTTGCCTGCCGTTCTGTTGCG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997525_1075997530 -7 Left 1075997525 10:126890627-126890649 CCGTTCTGTTGCGGGAAGTCAGG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997518_1075997530 7 Left 1075997518 10:126890613-126890635 CCGCCCCTTGCCTGCCGTTCTGT No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997519_1075997530 4 Left 1075997519 10:126890616-126890638 CCCCTTGCCTGCCGTTCTGTTGC No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997524_1075997530 -3 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997521_1075997530 2 Left 1075997521 10:126890618-126890640 CCTTGCCTGCCGTTCTGTTGCGG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997517_1075997530 8 Left 1075997517 10:126890612-126890634 CCCGCCCCTTGCCTGCCGTTCTG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997530 Original CRISPR AGTCAGGGACCCCAAACGGA GGG Intergenic