ID: 1075997536

View in Genome Browser
Species Human (GRCh38)
Location 10:126890673-126890695
Sequence GAAGCCATGGCAGAAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997525_1075997536 23 Left 1075997525 10:126890627-126890649 CCGTTCTGTTGCGGGAAGTCAGG No data
Right 1075997536 10:126890673-126890695 GAAGCCATGGCAGAAGAACGTGG No data
1075997533_1075997536 -4 Left 1075997533 10:126890654-126890676 CCAAACGGAGGGACCAGCTGAAG No data
Right 1075997536 10:126890673-126890695 GAAGCCATGGCAGAAGAACGTGG No data
1075997531_1075997536 -2 Left 1075997531 10:126890652-126890674 CCCCAAACGGAGGGACCAGCTGA No data
Right 1075997536 10:126890673-126890695 GAAGCCATGGCAGAAGAACGTGG No data
1075997524_1075997536 27 Left 1075997524 10:126890623-126890645 CCTGCCGTTCTGTTGCGGGAAGT No data
Right 1075997536 10:126890673-126890695 GAAGCCATGGCAGAAGAACGTGG No data
1075997532_1075997536 -3 Left 1075997532 10:126890653-126890675 CCCAAACGGAGGGACCAGCTGAA No data
Right 1075997536 10:126890673-126890695 GAAGCCATGGCAGAAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997536 Original CRISPR GAAGCCATGGCAGAAGAACG TGG Intergenic