ID: 1075998816

View in Genome Browser
Species Human (GRCh38)
Location 10:126899119-126899141
Sequence AACTGAACCCTGAGTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075998816_1075998821 21 Left 1075998816 10:126899119-126899141 CCAGTGAGACTCAGGGTTCAGTT No data
Right 1075998821 10:126899163-126899185 GCCCAAAGCTGCCTCCAGGAAGG No data
1075998816_1075998825 29 Left 1075998816 10:126899119-126899141 CCAGTGAGACTCAGGGTTCAGTT No data
Right 1075998825 10:126899171-126899193 CTGCCTCCAGGAAGGAAGCTGGG No data
1075998816_1075998824 28 Left 1075998816 10:126899119-126899141 CCAGTGAGACTCAGGGTTCAGTT No data
Right 1075998824 10:126899170-126899192 GCTGCCTCCAGGAAGGAAGCTGG No data
1075998816_1075998820 17 Left 1075998816 10:126899119-126899141 CCAGTGAGACTCAGGGTTCAGTT No data
Right 1075998820 10:126899159-126899181 CGCAGCCCAAAGCTGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075998816 Original CRISPR AACTGAACCCTGAGTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr