ID: 1075999902

View in Genome Browser
Species Human (GRCh38)
Location 10:126905884-126905906
Sequence TACCCCCAACTCCCCGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075999886_1075999902 24 Left 1075999886 10:126905837-126905859 CCTCCGACGCCCGCTCCTCTGGA 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999884_1075999902 25 Left 1075999884 10:126905836-126905858 CCCTCCGACGCCCGCTCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999889_1075999902 14 Left 1075999889 10:126905847-126905869 CCGCTCCTCTGGACCTCTGCCGT 0: 1
1: 0
2: 1
3: 16
4: 237
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999893_1075999902 1 Left 1075999893 10:126905860-126905882 CCTCTGCCGTGGAGCCCCCCGGG 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999895_1075999902 -5 Left 1075999895 10:126905866-126905888 CCGTGGAGCCCCCCGGGCTACCC 0: 1
1: 0
2: 1
3: 10
4: 206
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999888_1075999902 15 Left 1075999888 10:126905846-126905868 CCCGCTCCTCTGGACCTCTGCCG 0: 1
1: 0
2: 1
3: 27
4: 235
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999883_1075999902 26 Left 1075999883 10:126905835-126905857 CCCCTCCGACGCCCGCTCCTCTG 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999891_1075999902 9 Left 1075999891 10:126905852-126905874 CCTCTGGACCTCTGCCGTGGAGC 0: 1
1: 0
2: 1
3: 14
4: 118
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data
1075999887_1075999902 21 Left 1075999887 10:126905840-126905862 CCGACGCCCGCTCCTCTGGACCT 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075999902 Original CRISPR TACCCCCAACTCCCCGGCCC CGG Intronic
No off target data available for this crispr