ID: 1076000410

View in Genome Browser
Species Human (GRCh38)
Location 10:126908325-126908347
Sequence GAGTTGGTAAGGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 362}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076000410_1076000421 22 Left 1076000410 10:126908325-126908347 CCCTCCACCATCCTTACCAACTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 1076000421 10:126908370-126908392 ACAGGGCTGTGTTTCCCTGGAGG No data
1076000410_1076000422 30 Left 1076000410 10:126908325-126908347 CCCTCCACCATCCTTACCAACTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 1076000422 10:126908378-126908400 GTGTTTCCCTGGAGGCGCTCTGG No data
1076000410_1076000420 19 Left 1076000410 10:126908325-126908347 CCCTCCACCATCCTTACCAACTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 1076000420 10:126908367-126908389 ACAACAGGGCTGTGTTTCCCTGG No data
1076000410_1076000419 5 Left 1076000410 10:126908325-126908347 CCCTCCACCATCCTTACCAACTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 1076000419 10:126908353-126908375 TTTTTCGGAGCTTAACAACAGGG No data
1076000410_1076000415 -10 Left 1076000410 10:126908325-126908347 CCCTCCACCATCCTTACCAACTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 1076000415 10:126908338-126908360 TTACCAACTCCAGCATTTTTCGG No data
1076000410_1076000418 4 Left 1076000410 10:126908325-126908347 CCCTCCACCATCCTTACCAACTC 0: 1
1: 0
2: 1
3: 13
4: 362
Right 1076000418 10:126908352-126908374 ATTTTTCGGAGCTTAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076000410 Original CRISPR GAGTTGGTAAGGATGGTGGA GGG (reversed) Intronic
901731719 1:11284912-11284934 GATTTGGTAAGGGGGATGGAGGG + Intronic
902406860 1:16189104-16189126 GAGCTGGTCAGGAAGGAGGAAGG - Intergenic
903054299 1:20624800-20624822 AAGTAGATAAGCATGGTGGAAGG + Intergenic
904866987 1:33587123-33587145 GCGTTGGGGAGGATGGTGGGAGG + Exonic
905655298 1:39682827-39682849 GGGTTGGTGAGGATACTGGAAGG + Intronic
905936394 1:41827565-41827587 GCTTTGGTTAGGATGGGGGAGGG - Intronic
908878230 1:68701713-68701735 GAGTTGGTGGGGAGGGTGCAGGG - Intergenic
909432244 1:75602436-75602458 GAGTGGTTAAGGATTGTGGAGGG + Intronic
909581685 1:77243122-77243144 GAGTTGGTGAGGAGGGGGGCAGG + Intergenic
912263139 1:108129212-108129234 GAGATGGGAAGGATGGGAGAGGG - Intergenic
913028959 1:114878320-114878342 GAGTTGGTTCGGTTGGAGGAGGG + Intronic
914926340 1:151891799-151891821 GAGTTGCTGAGGATGCTGAATGG + Intronic
914999211 1:152572847-152572869 GAGTTGCTAAGAGTGGTGTAGGG + Intronic
915167286 1:153955218-153955240 GAGATGGCAAGGATGGCTGAAGG - Intronic
915346459 1:155199965-155199987 GAGATGGTAAGGACAGGGGAGGG - Intronic
915662982 1:157418975-157418997 GTATTGCTTAGGATGGTGGATGG + Intergenic
915708391 1:157869295-157869317 TAGTTGGTAGGGGTGGGGGAGGG + Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917544273 1:175946980-175947002 GAGGTTGTATGGATGCTGGATGG - Intronic
918313688 1:183305041-183305063 GATTTGGAAAGGATGCGGGATGG - Intronic
918415615 1:184303832-184303854 AAGCTGGGAAGGATGGTGGGAGG - Intergenic
920077618 1:203348651-203348673 GTGGTGGTAAGGATGGTAGTGGG + Intronic
920267787 1:204737559-204737581 GAGTGGGAAAGGATGGTGTGAGG - Intergenic
920418886 1:205816923-205816945 GAGTTTGTTAGGGTGGTGCAAGG - Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921412476 1:214850525-214850547 GTGTTGGGAGGGATGGAGGAGGG - Intergenic
923107428 1:230865424-230865446 GAGTTGGTAAAGATTATGGGAGG + Intronic
1062812541 10:477467-477489 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1062812555 10:477501-477523 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1064913508 10:20429776-20429798 GAGTTGGTGAGGATGTTGATGGG + Intergenic
1065289578 10:24216195-24216217 GAGTTGGGAAGGGAGATGGAAGG - Intronic
1069604604 10:69731544-69731566 GTGGTGGTAGTGATGGTGGAGGG + Intergenic
1069770149 10:70893482-70893504 GAGTGGGGAAGGATGAGGGAAGG + Intergenic
1069821156 10:71229556-71229578 GTGATGGGAAGGAGGGTGGATGG - Intronic
1069957394 10:72060472-72060494 GGGTTGTTAAGGATGCTGGGGGG - Exonic
1070358619 10:75664651-75664673 GAGTTGGAAAAGATGGGAGAAGG + Intronic
1071998157 10:91166970-91166992 TAGGTGGTCAGGATGGGGGAGGG + Intronic
1072424792 10:95320827-95320849 GTGTTGGTAGGGGTGGTGGCAGG - Intronic
1072791503 10:98321432-98321454 GAGGTGGTTAAGATGGAGGAGGG - Intergenic
1073809013 10:107132180-107132202 GAGGAGGTAAGGATGATGGGTGG - Intronic
1076000410 10:126908325-126908347 GAGTTGGTAAGGATGGTGGAGGG - Intronic
1076022672 10:127087085-127087107 GATGTGGTCAGGCTGGTGGAAGG + Intronic
1076108094 10:127840431-127840453 AGGTCGGTAAGGATGGTGGAGGG + Intergenic
1076722851 10:132400309-132400331 GAGTGGGTAAGGAGGGTGTGGGG + Intronic
1077316708 11:1922572-1922594 GAGCTGGAAGGGATGTTGGAAGG - Intronic
1077317817 11:1927145-1927167 GAGGTGGAAGGGAGGGTGGAGGG + Intronic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1077993873 11:7436144-7436166 GAGTGGATAGTGATGGTGGAAGG - Intronic
1078588918 11:12620813-12620835 GATTTGGTGTGGAAGGTGGATGG + Intergenic
1081748527 11:45489882-45489904 CAGGTGGCAGGGATGGTGGAGGG + Intergenic
1084114155 11:67032050-67032072 GAATGGGTAACGACGGTGGAAGG - Intronic
1084498994 11:69523785-69523807 CAGTTGGGAAGGGTGGTGGCAGG - Intergenic
1086010628 11:82098912-82098934 GTGTTGGCAAGGAAGCTGGAAGG - Intergenic
1086733264 11:90274802-90274824 GTGTAAGTAAGGATGCTGGAAGG + Intergenic
1087942325 11:104113323-104113345 GCATTGGCAAGGATGGGGGAGGG + Intronic
1089658348 11:119968818-119968840 GAGCTGGTGAAGATGGTGGCAGG + Intergenic
1090092445 11:123710369-123710391 GAGTGGGTAAGAGTGGGGGATGG + Intergenic
1090214825 11:124952771-124952793 GAGATAGTGAAGATGGTGGAAGG - Intergenic
1092038891 12:5365991-5366013 GGGTTTGAAAGGAAGGTGGAAGG + Intergenic
1096539347 12:52296287-52296309 GATCTGGGAAGTATGGTGGAAGG + Intronic
1096842936 12:54390423-54390445 GAGAGGGTAAGTATGGGGGATGG - Intronic
1097644951 12:62225114-62225136 AAGTTGGTGGGGATGGTGGCGGG + Intronic
1097891132 12:64778965-64778987 GATTTGGTAATGATGGGGAATGG + Intergenic
1098702509 12:73646359-73646381 GAGTTGGTGATGATGGTGAGTGG - Intergenic
1098818989 12:75207106-75207128 GACTGGGTAGGGATGGTGGCCGG + Intronic
1099089506 12:78287389-78287411 GAAATGGTGAGGATGGAGGAAGG - Intergenic
1100169827 12:91961450-91961472 GATTTGATAAGCGTGGTGGAGGG + Intergenic
1101117490 12:101546508-101546530 TAGTTGGAGAGGATGGGGGAAGG + Intergenic
1101767789 12:107718869-107718891 GAGCTGGTGGTGATGGTGGATGG - Intergenic
1103038248 12:117673653-117673675 GCCTTGGTAATGAGGGTGGATGG - Intronic
1103057415 12:117832795-117832817 GCCTAGGTAAGGCTGGTGGATGG - Intronic
1103425480 12:120830334-120830356 GAGGTGGAAAGGAGGGGGGAGGG + Intronic
1104104897 12:125649999-125650021 GATTAGGGTAGGATGGTGGAAGG + Intronic
1104275185 12:127320533-127320555 GATTAGGGCAGGATGGTGGATGG - Intergenic
1104382679 12:128321474-128321496 GAGATGGAGAGGGTGGTGGAGGG + Intronic
1105899191 13:24741713-24741735 CTGCTGGTAAGGATGCTGGAAGG - Intergenic
1107104900 13:36632508-36632530 GAGATGGAAAGGATGGTGGGGGG + Intergenic
1107224076 13:38026088-38026110 GAGGTGGTAGGGATGGTTGATGG - Intergenic
1107702032 13:43058374-43058396 GGGTTGGTGTGGGTGGTGGAAGG + Intronic
1107724476 13:43284514-43284536 AAGATGGTAATGGTGGTGGAGGG + Intronic
1107834917 13:44405295-44405317 GAGTGGGGAAGGAAGGTGGGAGG - Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1110247368 13:73342055-73342077 GGGTGGGAAAGGATGGGGGAGGG - Intergenic
1110469430 13:75842193-75842215 GCCTTGGCAAGGATGCTGGATGG - Intronic
1111892991 13:94106433-94106455 AAGTTGGAAAGTAAGGTGGAAGG + Intronic
1112380189 13:98881875-98881897 GACTCGGTAAGGGAGGTGGATGG - Exonic
1112703952 13:102044726-102044748 GAGTGGTGGAGGATGGTGGAAGG - Intronic
1113507753 13:110828820-110828842 GAGTTGTTACTCATGGTGGAAGG + Intergenic
1114059445 14:19006277-19006299 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
1114060944 14:19015448-19015470 GACTGGGTAAGGTTGGTGGCTGG - Intergenic
1114101312 14:19384531-19384553 GACTGGGTAAGGTTGGTGGCTGG + Intergenic
1114103101 14:19395474-19395496 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
1114210593 14:20610747-20610769 GATGTGGGAAGGATGGTGAAGGG + Intergenic
1114673097 14:24423479-24423501 GAGTTTGTAAGTGTGGTGGTGGG + Intergenic
1116409567 14:44606003-44606025 TTGCTGGTAAGGATGGAGGAAGG - Intergenic
1117105499 14:52393998-52394020 GGGTTGGGAAGGATGGGGCATGG - Intergenic
1117467856 14:56011828-56011850 AAGTTGGTAATTATGCTGGAAGG - Intergenic
1117573482 14:57073555-57073577 GTGTTGGGAAGGTTGGGGGAAGG - Intergenic
1118368244 14:65113887-65113909 GGGAAGGTAAGGCTGGTGGAGGG - Intergenic
1119999042 14:79282001-79282023 CAGCTTGTAAGGTTGGTGGAGGG + Intronic
1120844676 14:89115568-89115590 GGGTTGGCAGGGATGGAGGATGG - Intergenic
1120861291 14:89257139-89257161 GAGTTGTTGATGGTGGTGGATGG - Intronic
1121167339 14:91817784-91817806 GAGTTGGGGAAGATGGAGGAAGG + Intronic
1121507046 14:94485469-94485491 GAGTTTGTTAGGCTGGAGGAGGG + Intergenic
1121633328 14:95437251-95437273 GAGGGGGCAAGCATGGTGGAAGG - Intronic
1122374441 14:101248739-101248761 GAGGTGGGAAGGATGGTAGTGGG - Intergenic
1122772482 14:104103571-104103593 GAGCTGGTGCGGAAGGTGGACGG + Exonic
1128291482 15:66481763-66481785 GAGTTGACTAGGATGTTGGAGGG - Exonic
1129086875 15:73103268-73103290 GAGTTGGTAAGGGTCTTGAAGGG - Intronic
1129917790 15:79289654-79289676 AAGGTGGGAAGGAGGGTGGATGG - Intergenic
1130485945 15:84398606-84398628 GAGTTGGACAGAATGGAGGATGG + Intergenic
1130776497 15:86989899-86989921 AAGTTGGTCAGGATGGCGAAGGG + Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1132498534 16:274909-274931 GAGTTGGTAAGCTGGGTGGGTGG + Intronic
1132499401 16:278709-278731 GAGTGGGTAAGGATGGGGAGAGG - Intronic
1132890870 16:2203980-2204002 ATGTTGGCCAGGATGGTGGATGG - Intergenic
1132989803 16:2786871-2786893 GAGGGGGTGAGGATGGGGGAGGG - Intronic
1133268804 16:4600490-4600512 GACTTGGTAGGGATGGGGGGGGG - Exonic
1133677391 16:8087758-8087780 GAGACTGAAAGGATGGTGGAGGG - Intergenic
1135860663 16:26052759-26052781 GAGTTGGTGAGGACTGTTGAGGG - Intronic
1135918675 16:26628317-26628339 GAGATATTTAGGATGGTGGAGGG + Intergenic
1136096836 16:27962960-27962982 GAGTGGGAGAGGCTGGTGGATGG - Intronic
1137813981 16:51380646-51380668 GAGTTGGTGATGATGGTGGTGGG + Intergenic
1139426798 16:66885548-66885570 GACGTGGTAAGGCTGGTGGTGGG + Exonic
1139646160 16:68332317-68332339 TAGTTGGCAAGAATGGTGGGAGG - Intronic
1141065173 16:80908424-80908446 TAGTTGGTAAGGACAATGGAAGG - Intergenic
1142111215 16:88332699-88332721 GAGATGGGCAGGATGGGGGAGGG + Intergenic
1142263390 16:89052693-89052715 GAGTTGGCACGGATGGAGGCTGG + Intergenic
1143545315 17:7591840-7591862 GAGTTGGGTAGTATGGTGAATGG - Exonic
1144322135 17:14137073-14137095 GAGTTGGTGAGGATGCTAGAAGG + Intronic
1144874611 17:18390906-18390928 GAGGTGGTAATGCTGGTGGGGGG - Intergenic
1145157615 17:20553515-20553537 GAGGTGGTAATGCTGGTGGGGGG + Intergenic
1146071199 17:29683458-29683480 GAGTTAAAAAGGATGGTGGGCGG - Intronic
1147316265 17:39621891-39621913 GTGTGTGTAAGGCTGGTGGAGGG + Intergenic
1148342476 17:46881565-46881587 GAGGAGGTGAGGATGGTGTATGG - Intronic
1148450845 17:47777132-47777154 CAGTGGGTGAGGCTGGTGGAGGG - Intergenic
1149848543 17:60021568-60021590 GAGGTGGTAATGCTGGTGGGGGG + Intergenic
1149861626 17:60124956-60124978 GAGGTGGTAATGCTGGTGGGGGG - Intergenic
1150552137 17:66220710-66220732 ACGTAGGTATGGATGGTGGAGGG + Exonic
1150912933 17:69408055-69408077 GAGTAGGTTAGGAAGGTGCAGGG + Intergenic
1155906926 18:31462917-31462939 GAGTTGGTAATTAGGGTTGAAGG - Intronic
1156360428 18:36379929-36379951 GAGTTGAAAAGGAGGATGGATGG + Intronic
1156716539 18:40019158-40019180 GAGTTTGTTTGGGTGGTGGAGGG + Intergenic
1158098478 18:53802853-53802875 ATGTTGGTGAGGATGGTGGTGGG - Intergenic
1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG + Intergenic
1160324951 18:77937383-77937405 GAGCTTGTGAAGATGGTGGAAGG + Intergenic
1160677182 19:397684-397706 TAGGTGTTCAGGATGGTGGACGG - Intergenic
1161290145 19:3489649-3489671 GTGTTAGCCAGGATGGTGGATGG - Intergenic
1161604895 19:5209280-5209302 GAGTTGTGAAGGATGGAAGATGG - Intronic
1162865676 19:13544863-13544885 GAGGTGGTGAAGATGCTGGATGG - Intronic
1166416216 19:42596339-42596361 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166432947 19:42741890-42741912 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166436053 19:42767116-42767138 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166445934 19:42857144-42857166 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166448914 19:42881104-42881126 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166453314 19:42919295-42919317 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166471734 19:43084083-43084105 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166482872 19:43187899-43187921 GAGTTGATGAGGATGGAGGGAGG + Intronic
1166485354 19:43207033-43207055 GAGTTGATGAGGATGGAGGGAGG + Intronic
1167697603 19:51024479-51024501 GAGTTGGTATTGAAGGTGGGGGG - Intronic
1168520684 19:57048084-57048106 GAGATGGTAGAGAAGGTGGAGGG - Intergenic
924960244 2:28228-28250 GAGCTGGGAAGGAAGGTGAAGGG + Intergenic
926803411 2:16682748-16682770 GAGCTAGTAAGGATGAGGGAAGG + Intergenic
927017461 2:18979991-18980013 GAGTGGGTCAGGGTGATGGATGG + Intergenic
929555312 2:42922131-42922153 CAGTAGATTAGGATGGTGGATGG - Intergenic
929668504 2:43851973-43851995 GGGTTTGAAAGGAGGGTGGAGGG - Intronic
929680110 2:43985490-43985512 GGGTTCGGAAGGAGGGTGGAAGG - Intronic
932480802 2:72037964-72037986 GAGTTGGTGGGGTTGGGGGAGGG - Intergenic
933026374 2:77264410-77264432 GAGTTTATAAGGATGGGGTATGG - Intronic
934494747 2:94787634-94787656 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
934609339 2:95722998-95723020 AGGTTAGTGAGGATGGTGGAGGG + Intergenic
934758468 2:96840399-96840421 GACTTGGTGAGGATGGGGAAAGG - Exonic
934759142 2:96843949-96843971 CAGTTGGTAAGGATGTGGGACGG - Exonic
935727488 2:106036602-106036624 GAGTTTGAAAGGATAGTGAAGGG - Intergenic
936555859 2:113498515-113498537 GAGGTGGGAAGGAAGGTAGAAGG + Intergenic
936972513 2:118188708-118188730 GACTTGGTAAGGTTGGTGGAAGG + Intergenic
937073098 2:119079744-119079766 GAGTTGGTAGGTAAGGTGGTGGG + Intergenic
937468303 2:122154080-122154102 GAGTAGGGAAGCATGGTGCATGG - Intergenic
938281766 2:130068373-130068395 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
938332387 2:130456922-130456944 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
938357420 2:130663746-130663768 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
938433856 2:131270533-131270555 GAGTGGGTGAGGTTGGTGGCTGG + Intronic
938477892 2:131633179-131633201 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941597790 2:167499680-167499702 GATTTGGTGGGGACGGTGGAAGG - Intergenic
944397819 2:199289468-199289490 GAGTAGATAAGGATGCTGAATGG - Intronic
945195576 2:207234540-207234562 GAGGGGGTAGGGATGGTGGGGGG - Intergenic
945362213 2:208906078-208906100 TATTTGGTAAAAATGGTGGATGG + Intergenic
945503894 2:210613944-210613966 GAGAGTGTAAGGACGGTGGAGGG + Intronic
945565376 2:211391540-211391562 GGGTTTGTAAGGGTGATGGATGG + Intronic
945569094 2:211441708-211441730 GACATGGTAAGGAGGATGGAAGG - Intronic
946401653 2:219471733-219471755 GAGTGGGCAAGGATGGGGCAAGG - Intronic
947488753 2:230575905-230575927 TAATCGGTAAGGCTGGTGGAGGG - Intergenic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
948331468 2:237170130-237170152 GAGTTGGTGAGAAAGGGGGATGG - Intergenic
948681597 2:239638810-239638832 GAGATAATAAGGCTGGTGGATGG + Intergenic
1169155628 20:3327364-3327386 GAGTGGGGAAAGATGGGGGAGGG + Intronic
1169608807 20:7355156-7355178 GAGTTATTAAGGATGGTAGGGGG - Intergenic
1171370900 20:24661416-24661438 GAGTTAGGAAGGAGGGAGGAAGG + Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1173352374 20:42256956-42256978 GAGATGGTAAAGCTGGAGGAAGG - Intronic
1173631618 20:44520602-44520624 GAGTGGGGAAGGACGGTGGGGGG + Intronic
1174086400 20:48011187-48011209 GTGTTGGTAGTGATGGTGAAGGG - Intergenic
1174983400 20:55422428-55422450 GAGATGGAAAGGATGGGTGAGGG - Intergenic
1177853451 21:26376197-26376219 GGGTTGGTAATGATGGGAGATGG + Intergenic
1179313799 21:40223031-40223053 AGGTTGGTAGGGATGCTGGAGGG - Intronic
1180148470 21:45935214-45935236 GACATGGTTAGGCTGGTGGAAGG - Intronic
1180169184 21:46049092-46049114 GAGTTGGTCAGCAGGGTAGAGGG - Intergenic
1180477925 22:15728892-15728914 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
1180479427 22:15738060-15738082 GACTGGGTAAGGTTGGTGGCTGG - Intergenic
1181726701 22:24816304-24816326 GACTTGAAAAGGATGGAGGATGG - Intronic
1181852993 22:25763251-25763273 GAGGGGGCGAGGATGGTGGAGGG - Exonic
1182617257 22:31595737-31595759 GAGAGGGTGAGGATGGTGGCTGG + Intronic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
949985588 3:9538143-9538165 GAGATGCCAAGGATGGCGGATGG - Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951480479 3:23156275-23156297 AGGTTGGAAAGGATGGGGGAAGG + Intergenic
954753889 3:52828565-52828587 GAGTTGGGAAGGGTAGGGGAGGG + Intronic
955006474 3:54973374-54973396 GAGTTAGCAAAGACGGTGGAAGG + Intronic
955609855 3:60745419-60745441 GAGTTGGTAGGGACCGTGCAAGG + Intronic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
957821484 3:85381366-85381388 GAGTTGATACTGATGGTAGAAGG + Intronic
959244979 3:103854551-103854573 AAGCTGGGAAGGATAGTGGAGGG + Intergenic
960449238 3:117785975-117785997 GAGTTTGTAAGATTGGAGGAGGG + Intergenic
961283494 3:125781718-125781740 TAGATGGTAAGGTGGGTGGATGG - Intergenic
961427912 3:126862036-126862058 GAGTTGGTGATGGTGGAGGAGGG - Intronic
961428138 3:126862801-126862823 GAGTTGGTGATGGTGGTAGAGGG - Intronic
961428178 3:126862939-126862961 GAGTTGGTGATGGTGGTAGAGGG - Intronic
962005644 3:131346752-131346774 TAGCTGGTAAGTATGGTGGGAGG + Intronic
962401247 3:135060912-135060934 GAGGAGGTAGGGATGGTGAATGG - Intronic
963121541 3:141780849-141780871 GAGTTGGAAAGGAGGGGAGAGGG + Intronic
966055866 3:175688670-175688692 GAGATGGAGAGGAGGGTGGATGG + Intronic
966906330 3:184528479-184528501 GTGATGGTGAGGATGGTGGTGGG + Intronic
967355574 3:188566573-188566595 GATTTGGTATGAATGTTGGAGGG - Intronic
967626337 3:191689189-191689211 GATTTGGTCAGGATGGTGGGAGG - Intergenic
967968522 3:194982952-194982974 GATATGGTAAGCATGGTGTAAGG - Intergenic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
970617639 4:17782191-17782213 GAGGTAGAAAGGATGGTGGCAGG + Intergenic
971557612 4:28034705-28034727 GAGTAGGTAGGGATGGTTAATGG + Intergenic
973097674 4:46223226-46223248 GAGCTGGTGAGTGTGGTGGAGGG - Intergenic
974670277 4:65021518-65021540 GAGTTTTTAATCATGGTGGAAGG + Intergenic
975006121 4:69288746-69288768 GAGATGTATAGGATGGTGGAGGG - Intronic
975128355 4:70807406-70807428 GACTTGGAAAGGAAGATGGAGGG - Intergenic
976634467 4:87273808-87273830 TAGTTTGCAAGAATGGTGGAGGG + Intergenic
977540799 4:98316510-98316532 GAGTTGTTCAGGATGATGGCAGG + Intronic
977891304 4:102314528-102314550 GAGTTGGTGGGGAAGGTAGAAGG - Intronic
978348873 4:107800358-107800380 GAGTTGGAAAGGGTGGAGCAGGG + Intergenic
979436454 4:120698416-120698438 GACTTAGTTAGGATGGAGGAAGG - Intronic
980797670 4:137705818-137705840 GAGTTCGTATAGATGGTAGATGG - Intergenic
981574344 4:146188612-146188634 GAGTAGGCATGGAAGGTGGAAGG + Intronic
981812238 4:148789188-148789210 GAGTGGGTACAGATAGTGGAAGG + Intergenic
983454089 4:167940816-167940838 GAGGACGTAGGGATGGTGGATGG - Intergenic
983568543 4:169179902-169179924 GCCTTGGTAATCATGGTGGATGG + Intronic
983603295 4:169554652-169554674 GAGTTGGGAGGGAGGTTGGAGGG + Intronic
985091204 4:186364243-186364265 CAGGTGGTGAGGATGGGGGAGGG - Intergenic
985757196 5:1725997-1726019 GGGTTTGTTTGGATGGTGGAGGG + Intergenic
986836850 5:11648387-11648409 GAGTTGATAAGGTTGGAGAAAGG - Intronic
987412259 5:17626123-17626145 GAGTTGGTAAGTATGGGGCTGGG - Intergenic
987795744 5:22625456-22625478 GAGTTGGTTGGGAAGGTGGCAGG + Intronic
988732338 5:33984689-33984711 GAGATGGTCAGGCTGGGGGAGGG + Exonic
989556775 5:42806102-42806124 GAGGTGGGAAGTGTGGTGGAAGG + Intronic
989623838 5:43410694-43410716 GAGTAGGTCAGGAAGCTGGATGG + Intronic
990271712 5:54148692-54148714 CATTGGGTAAGGATGGTGGCTGG + Intronic
990958787 5:61370981-61371003 CAGTTGGTAAAGGTTGTGGAGGG + Intronic
992275861 5:75117508-75117530 CAGTTGGTAAGGATGTTGGTAGG + Intronic
993958910 5:94272181-94272203 GAGTTGGGAAGGGTAGTGGGGGG + Intronic
994608160 5:101997549-101997571 GAGTTGGGAAGGAGGGAGGGAGG - Intergenic
996546975 5:124690205-124690227 TAGTTGCTAGGGATGGGGGAAGG + Intronic
996861761 5:128074862-128074884 GACTTTATAAGGGTGGTGGAAGG + Intergenic
997312231 5:132896634-132896656 GAGTTTGTGAGGAAGGAGGAAGG + Exonic
997374073 5:133384476-133384498 GACTGGCTAAGGATGGAGGAAGG + Intronic
997483061 5:134204035-134204057 GAGTTGGACTAGATGGTGGAAGG - Intronic
997707496 5:135971713-135971735 GACTTGGGAAGGGTGGGGGAGGG - Intergenic
997842877 5:137257929-137257951 GACTTGGTGAGGACTGTGGAGGG - Intronic
998196425 5:140076727-140076749 GAGAAGGAAAGGATGGTAGATGG - Intergenic
999661765 5:153871775-153871797 GAGTTGGTAAGGAAGAAGCAGGG - Intergenic
999873771 5:155779784-155779806 GTGTTGGCAAGGATGCAGGAGGG - Intergenic
1000262096 5:159597885-159597907 GAATTGGGAAAGATGGTGGATGG - Intergenic
1000337148 5:160250204-160250226 GAGATGGTCAAGTTGGTGGATGG - Intergenic
1000849098 5:166318007-166318029 GAGTTGGAAAGGAGGGGAGAGGG - Intergenic
1001701371 5:173708945-173708967 GAGTGGGTGAGGATGGAGGCCGG - Intergenic
1001997514 5:176174045-176174067 GGGTTGGTGGGGATGTTGGAAGG - Intergenic
1002924496 6:1597217-1597239 GGGCTGGTAAGGAGGGTTGAGGG - Intergenic
1003707507 6:8550266-8550288 GAGGCGGTAGGGATGGTGAATGG + Intergenic
1006977233 6:38114574-38114596 TAGTTGCTAAGAATGGTGCAGGG + Intronic
1008130641 6:47716948-47716970 GAGTTTGTGAGGATGGTTCAAGG + Intronic
1013093459 6:106922129-106922151 AAGAAGGTAACGATGGTGGAAGG - Intergenic
1013610229 6:111787914-111787936 GGGTTTGGAATGATGGTGGATGG - Intronic
1016902418 6:149115495-149115517 GAGTAGGTCAGGAAGGAGGAAGG + Intergenic
1020027922 7:4912196-4912218 GAGGTGTTCAGGAGGGTGGAGGG + Intronic
1020527108 7:9275724-9275746 GAGATGGTGAGGTTGGAGGATGG + Intergenic
1021294258 7:18884795-18884817 GAATAGGTAAGGAAGGTCGAAGG - Intronic
1021478800 7:21093147-21093169 GAGTTGGCAAGTATAGTGTATGG + Intergenic
1021740932 7:23684501-23684523 TTGTTGGTGAGGATGATGGAGGG + Exonic
1021816549 7:24452702-24452724 GAGTTAGTGAAGATGGGGGAAGG + Intergenic
1026011880 7:66642809-66642831 GAGTGGGGAAGGATGGGGGTTGG + Exonic
1026487597 7:70834928-70834950 GAGCTTGCAATGATGGTGGAAGG + Intergenic
1027059145 7:75071726-75071748 CAGTTGGTAAGGATGGGGCCAGG - Intronic
1029675781 7:102067686-102067708 GAGTTGCTAATAATGGGGGAGGG + Intronic
1029942262 7:104492876-104492898 GAGTGGCAATGGATGGTGGAAGG - Intronic
1032097673 7:128947586-128947608 GGATTGGCAAGGAGGGTGGAGGG + Intronic
1032610633 7:133408488-133408510 AGGGTGGTAAGGATGATGGAGGG + Intronic
1032704932 7:134413479-134413501 CACCTGGTCAGGATGGTGGATGG + Intergenic
1032823650 7:135548399-135548421 TAGATGGTAAGGATGGTTGCAGG + Intergenic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033603881 7:142910918-142910940 GTGTTGGTGATGGTGGTGGAGGG - Intronic
1033762979 7:144456728-144456750 GAGTTTGTAAAGCTGGTGAATGG - Intronic
1034213158 7:149382695-149382717 AAGTGGGAAAGGATGTTGGATGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414063 7:158668175-158668197 GGGTCGGTAAGGAAGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035706969 8:1683272-1683294 GATTTGGTCAAGGTGGTGGATGG + Intronic
1036166466 8:6438825-6438847 GAGTAGGTAATGATGTTGAAAGG + Intronic
1036776766 8:11618016-11618038 GAGTTGGGAAGGAAGGTGTAGGG + Intergenic
1037368297 8:18146025-18146047 AAGTTGTTAGGGATGTTGGAGGG - Intergenic
1038112287 8:24513082-24513104 TGGTTGGGAAGTATGGTGGATGG - Intronic
1038470036 8:27807834-27807856 GAATGGGTCATGATGGTGGAAGG + Intronic
1038693819 8:29787182-29787204 GAGTTTTTAATCATGGTGGAAGG - Intergenic
1039790390 8:40871364-40871386 GAGTGGGTAGGGATGGAGTAGGG - Intronic
1040101916 8:43513243-43513265 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
1042131632 8:65593255-65593277 GAGTTTCTAAGGATGGGGCAAGG - Intergenic
1043277391 8:78416358-78416380 GAGTTGGCAAGGATTGTGCGTGG - Intergenic
1043765139 8:84121563-84121585 GAGTTTATAATCATGGTGGAAGG + Intergenic
1044837077 8:96306219-96306241 GAGGTGGCAGGGGTGGTGGATGG - Intronic
1045036593 8:98180952-98180974 GAGTAGGGAAGGATGGAGCAAGG + Intergenic
1047766039 8:127990846-127990868 GTGTCTGTGAGGATGGTGGAGGG + Intergenic
1048836689 8:138525465-138525487 GGGTTATTAAGGATGGAGGAGGG - Intergenic
1049247746 8:141571769-141571791 GTGTGGGAAAGGATAGTGGAAGG - Intergenic
1049897164 9:118838-118860 GAGGTGGGAAGGAAGGTAGAAGG - Intergenic
1052314843 9:27105693-27105715 GAGGTGGTGAGGATGGTTAATGG - Intergenic
1052877181 9:33575814-33575836 GAGTGGGTGAGGCTGGTGGCTGG - Intergenic
1053130284 9:35610585-35610607 GAGTTGGTAAGAGTGAGGGATGG - Exonic
1053348066 9:37392677-37392699 GAGTTAGGAAAGATGGTGGTGGG - Intergenic
1053498820 9:38568580-38568602 GAGTGGGTGAGGTTGGTGGCCGG + Intronic
1053662371 9:40292725-40292747 GAGTGGGTGAGGTTGGTGGCTGG - Intronic
1053740267 9:41129103-41129125 GAGGTGGGAAGGAAGGTAGAAGG - Intergenic
1053912824 9:42922890-42922912 GAGTCGGTGAGGTTGGTGGCTGG - Intergenic
1054374500 9:64438954-64438976 GAGTGGGTGAGGTTGGTGGCTGG - Intergenic
1054443229 9:65285096-65285118 GAGGTGGGAAGGAAGGTAGAAGG - Exonic
1054487051 9:65736405-65736427 GAGGTGGGAAGGAAGGTAGAAGG + Intergenic
1054522239 9:66083559-66083581 GAGTGGGTGAGGTTGGTGGCTGG + Intergenic
1054688082 9:68302210-68302232 GAGGTGGGAAGGAAGGTAGAAGG + Intergenic
1057283006 9:93726283-93726305 GAGCTGGTCTGGAAGGTGGAGGG + Intergenic
1057531496 9:95851040-95851062 GAGTTGTTAGGGATTTTGGAAGG + Intergenic
1058069299 9:100585380-100585402 GAAATGGAGAGGATGGTGGATGG + Intronic
1058730095 9:107841485-107841507 GAGTAGGTAAGAATGGGGGTTGG - Intergenic
1058943491 9:109835317-109835339 GAGATGGAGAGGAGGGTGGAGGG + Intronic
1059679783 9:116574957-116574979 TAGTTGGTATGGATGCTGAAGGG - Intronic
1062631869 9:137466727-137466749 GAGTTGGTGGAGATGGTGGTGGG - Intronic
1186128615 X:6442725-6442747 GAGATGGTAAGTGTGGAGGATGG + Intergenic
1186169604 X:6862813-6862835 AATTTGCAAAGGATGGTGGATGG + Intergenic
1188239864 X:27772777-27772799 GAGTGGGGAAGCACGGTGGAAGG + Intergenic
1189693776 X:43642927-43642949 GAGTTGGCATGGGTGGAGGAAGG - Intergenic
1190216164 X:48480803-48480825 GAGATGGGGAGGATGGTGGGAGG + Intronic
1190712169 X:53078978-53079000 GTGTAGGTAAGGGTGGGGGAAGG - Exonic
1197306162 X:124844503-124844525 GGGGTGGTAATCATGGTGGAGGG + Intronic
1199279130 X:145978651-145978673 TAGTTGGTGGGGATGGTTGATGG + Intergenic
1199341065 X:146677990-146678012 GATTTGGTCAGCATGGTGGAGGG + Intergenic
1199976668 X:152898338-152898360 GAGCTGGTAAGGGTTATGGATGG - Intergenic
1200268373 X:154658875-154658897 GAGTTGGGAAGGATGTAGCAGGG + Intergenic
1200828969 Y:7672433-7672455 GATATGGTAAGGATCCTGGATGG - Intergenic
1202368477 Y:24182465-24182487 GAGTTGGACAGAATGGAGGATGG + Intergenic
1202502308 Y:25487652-25487674 GAGTTGGACAGAATGGAGGATGG - Intergenic