ID: 1076001065

View in Genome Browser
Species Human (GRCh38)
Location 10:126913418-126913440
Sequence CAGTGCCCCCTGGAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076001065_1076001068 3 Left 1076001065 10:126913418-126913440 CCACACAACTCCAGGGGGCACTG 0: 1
1: 0
2: 2
3: 33
4: 214
Right 1076001068 10:126913444-126913466 TTCTCCACAGCCCACGAGGCTGG No data
1076001065_1076001067 -1 Left 1076001065 10:126913418-126913440 CCACACAACTCCAGGGGGCACTG 0: 1
1: 0
2: 2
3: 33
4: 214
Right 1076001067 10:126913440-126913462 GTTCTTCTCCACAGCCCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076001065 Original CRISPR CAGTGCCCCCTGGAGTTGTG TGG (reversed) Intronic
900420099 1:2552579-2552601 CACTGCACCATGAAGTTGTGGGG - Intergenic
900424330 1:2569079-2569101 CACTGCACCATGAAGTTGTGGGG + Intergenic
900524986 1:3124166-3124188 CAGTGGCTCCTGGAGTCCTGGGG + Intronic
900585349 1:3429969-3429991 CAGTGCCCCCGGGCGGAGTGAGG + Intronic
900681514 1:3919389-3919411 CAGTGCCAGCTGCTGTTGTGGGG + Intergenic
901643097 1:10702982-10703004 GAGAGCGCCATGGAGTTGTGGGG + Intronic
902047929 1:13539867-13539889 TGGTGCCCCCTGGAGGTGTGCGG + Intergenic
903592805 1:24470041-24470063 CAGTGCCCCCTGGAAAGATGGGG + Intronic
903925039 1:26826220-26826242 GAGTGCCCACTGGAGGTGTGTGG - Intergenic
904165173 1:28549844-28549866 CAGTCCCCTCTGGGGTTGTTGGG + Intergenic
904446288 1:30575447-30575469 CAGTCTCCCCTGGAGATATGAGG - Intergenic
904909196 1:33921489-33921511 CAGTTCCACCTGGTGTAGTGAGG - Intronic
906516544 1:46442442-46442464 CAGCGCCACCTGGAGTTGAAAGG - Intergenic
906535259 1:46547848-46547870 CAGGTCCCCATGGAGTTGTCAGG + Intronic
907891350 1:58639470-58639492 CAGTGGCCCCTGCAGTTGAGAGG - Intergenic
909312811 1:74175075-74175097 CAGTGCACCCTGGGATTCTGGGG + Intronic
912418575 1:109528508-109528530 GAGTGCACCCTGGGCTTGTGAGG + Intergenic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
913614372 1:120542669-120542691 AAGTGCCTCATGGACTTGTGAGG + Intergenic
914762827 1:150612736-150612758 AAATGCCCCCTGGAGTTGCCTGG - Intronic
916018900 1:160776029-160776051 CAGTGTCCCCTGGATATCTGGGG - Intergenic
916212919 1:162373085-162373107 CAGTGCCCACTGCAGTGGAGGGG + Intronic
916792102 1:168134448-168134470 CAGTGCTACCTGGAGTTTGGAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917970347 1:180202020-180202042 CAGTGCAACCTGGAGTGATGGGG - Exonic
919409660 1:197227715-197227737 CACTGCCTCGTGGAGCTGTGTGG - Intergenic
920242388 1:204562571-204562593 CAGTGACGCCTGGAGTCGGGCGG - Intergenic
921078862 1:211722780-211722802 AAGTGTCCCTTGGAGTTGTAAGG + Intergenic
1064698158 10:17988809-17988831 CAGTGAGCCGTGGAGCTGTGGGG - Intronic
1065814304 10:29470476-29470498 CGGTGCCCCCTGCAGGTGAGTGG - Exonic
1066323330 10:34327681-34327703 CAGTGCACCCTGGAAATGCGTGG - Intronic
1067346964 10:45444012-45444034 CAGGGCCCGCTGGAGTTGGGGGG + Intronic
1067966881 10:50923302-50923324 CAGTGCCTAGTGGAGCTGTGAGG - Intergenic
1068445416 10:57115840-57115862 CAGTACCCCCTGTGGTTCTGTGG + Intergenic
1070745223 10:78929720-78929742 CAGTGGCCCTTGGTGTTGTAAGG + Intergenic
1070832938 10:79431371-79431393 CAGGACCCACTGGAGATGTGGGG + Intronic
1072532905 10:96336326-96336348 CACTGCCCCCTGCATTTGAGGGG - Intronic
1074415803 10:113265735-113265757 CAGTTCACCCTGGAGTTCTCAGG - Intergenic
1074831038 10:117249340-117249362 CCGTGCCCCCTGGAATTCTCTGG + Intronic
1076001065 10:126913418-126913440 CAGTGCCCCCTGGAGTTGTGTGG - Intronic
1076345281 10:129775039-129775061 CAGTGACCCCTGCAGATCTGGGG - Intergenic
1077227344 11:1444225-1444247 GAGTGCCCCCAGCAGCTGTGGGG + Intronic
1077315777 11:1918814-1918836 CGGTGCCACCTGGAGTCCTGAGG + Intergenic
1078049396 11:7948647-7948669 CAGTGCCTGCTGGTGTTGTCAGG - Intergenic
1078250858 11:9615166-9615188 CTGTGCCCCTTGGAGTTTTGGGG - Intergenic
1079087096 11:17454331-17454353 CACTGCTCCCTGGAGCTGTCTGG + Intronic
1079873501 11:25829521-25829543 CAATGCCCAGTGGGGTTGTGGGG - Intergenic
1081635814 11:44721198-44721220 CTGTGCCTCATGGAGTTGTTTGG + Intergenic
1081989873 11:47332071-47332093 GAGTGCCGCCTGGAGGTGCGAGG - Exonic
1083117984 11:60482678-60482700 TAGTATCCCCTGGAGTTGAGAGG - Intergenic
1084401141 11:68943824-68943846 CAATTCCCCATGGATTTGTGGGG + Intergenic
1084602603 11:70155086-70155108 CAGCCCACCCTGTAGTTGTGTGG + Intronic
1088256073 11:107904634-107904656 GTGTACCCCCTGCAGTTGTGGGG - Intronic
1089143718 11:116309121-116309143 CAGGGCTCCCTGGAGTTGGGCGG - Intergenic
1089615659 11:119693282-119693304 CTTTGCCTCCTGGAGCTGTGGGG + Intronic
1090012797 11:123060523-123060545 CAGTGCCCCCGGGAGTCATCGGG + Intronic
1091742499 12:2969840-2969862 CACTGCTCTCTGGGGTTGTGGGG - Intronic
1091777258 12:3192590-3192612 CAGTCCCTCCTGGAGCTGTCTGG + Intronic
1092111211 12:5966046-5966068 CAGTGCCCTCTGGTGTTCAGAGG - Intronic
1092111242 12:5966203-5966225 CAATGCTGCCTGGAGTCGTGTGG - Intronic
1092166871 12:6347914-6347936 CAGAGCCCCCTGGAGATGGGCGG + Exonic
1094372332 12:29751677-29751699 CAGTGTCCCCACGAGCTGTGTGG - Exonic
1094617588 12:32049711-32049733 CAGCGGCCCCTGGAGTTCTCAGG + Intergenic
1095098837 12:38161629-38161651 CAGTGACGCCTGGAGTCGGGCGG - Intergenic
1096125591 12:49117105-49117127 CTGTGCCCTCTGGGGTTTTGAGG + Intergenic
1098703982 12:73664638-73664660 AAGTGTCCCTAGGAGTTGTGGGG - Intergenic
1101531096 12:105574375-105574397 CAGTGCCTGCTGGGGTTGTGTGG + Intergenic
1101948693 12:109157681-109157703 AAGAGCCCTCTGGAGTTGGGAGG + Intronic
1102344855 12:112153084-112153106 CACTGCCCCTTGGTGCTGTGTGG + Exonic
1102907514 12:116688131-116688153 CAGTGCCCCCTGGTGTTGGGCGG + Intergenic
1103026301 12:117576990-117577012 CCTTTCCTCCTGGAGTTGTGGGG - Intronic
1103859893 12:124003866-124003888 CAGTGCCCATTTGAGATGTGTGG + Intronic
1104638476 12:130452333-130452355 CACTCCAGCCTGGAGTTGTGGGG - Intronic
1104841720 12:131828908-131828930 CAGGAGCCCGTGGAGTTGTGAGG + Intronic
1104973945 12:132543766-132543788 CAGTGGCCCCTGGGGTGGTTGGG + Intronic
1105204564 13:18209829-18209851 CAGTGCCCCATGGAGGAGGGAGG - Intergenic
1106361109 13:29031178-29031200 CAGTGCCCCCCAGAGATGAGTGG - Intronic
1107914052 13:45131262-45131284 CAGTGCCCACTGAAGTTAAGGGG + Intronic
1107958617 13:45540429-45540451 CAGAGCTCCCTGGAGTGGGGTGG + Intronic
1113397461 13:109961990-109962012 CACTGCCCCCAGGAGGGGTGTGG - Intergenic
1113676839 13:112213669-112213691 CACTGCCCCCTGCAGGTGTGGGG + Intergenic
1118372511 14:65149510-65149532 TGGTACCCCCTGGAGTTGTGTGG - Intergenic
1118904437 14:70013470-70013492 CAGCGCCCACTGGAGGTGGGAGG + Exonic
1120745137 14:88145533-88145555 AGGTGCCCCCTGGAATTCTGGGG - Intergenic
1121102740 14:91261340-91261362 CCCTGCCCTCTGGAGGTGTGGGG + Intergenic
1121156334 14:91688423-91688445 CAGTGCTCCCTGGAATTTAGTGG + Intronic
1122113457 14:99516570-99516592 CAGGGCCCGCTGGAGATGAGTGG + Intronic
1123042777 14:105497167-105497189 CAGGGCACCCTGGTGTGGTGCGG - Intronic
1125619261 15:41045106-41045128 CAGTGCTCCATGGAGGTTTGAGG + Intronic
1126158505 15:45587259-45587281 CTCTGCCCCATGGCGTTGTGGGG - Exonic
1126254018 15:46603559-46603581 CAGAACCACCTGGAGTTATGTGG - Intergenic
1126796914 15:52266966-52266988 CAAAGCCCTCTGGAGTTTTGTGG - Intronic
1127983407 15:64050519-64050541 CAGTGCCCCCGGGGGTGGGGGGG - Intronic
1129607424 15:77031677-77031699 CAGGACACCCTGGAGATGTGGGG - Intronic
1129843729 15:78758781-78758803 GACTGCCCCCTGGAGTGGTGGGG - Intergenic
1129868052 15:78924061-78924083 CAGAGCCCCCAGGAGGTGGGGGG + Intronic
1130258076 15:82335019-82335041 GACTGCCCCCTGGAGTGGTGGGG + Intergenic
1130596856 15:85254944-85254966 GACTGCCCCCTGGAGTGGTGGGG - Intergenic
1131791496 15:95970589-95970611 CAGTGACACCTGGATTCGTGGGG + Intergenic
1132590691 16:725131-725153 CACTTCCCCCTGCAGCTGTGGGG + Exonic
1132958670 16:2610299-2610321 CTGTGACCCCTGGAGATGGGTGG + Intergenic
1138553840 16:57760988-57761010 CCCTGCCCCTTGGGGTTGTGGGG + Intronic
1139441618 16:66970794-66970816 CACTGCCCTCTGGAGCTGAGGGG + Intronic
1139820199 16:69715058-69715080 CAGTTCCCCCTGCAGTGGTTTGG - Exonic
1140230812 16:73115693-73115715 CAGTGCCTCCTATAATTGTGAGG - Intergenic
1140521188 16:75583240-75583262 CAGCACCTCCTAGAGTTGTGTGG + Intergenic
1143094955 17:4473864-4473886 CTGTGGCCCCTGGAGTGGTGCGG + Intronic
1143631833 17:8144204-8144226 CAGTGCCCACAGGAGTTTGGCGG - Intronic
1144937650 17:18913128-18913150 CAATGCCCAGTGGAGTTGTGGGG - Intronic
1146641626 17:34546317-34546339 TGGTGCCCCCTTAAGTTGTGCGG + Intergenic
1147790938 17:43014018-43014040 CAGTGCCCCATGGGGGTATGAGG - Intronic
1147866340 17:43555167-43555189 CAGTACCCCCTGGGGAGGTGAGG - Intronic
1148578510 17:48727747-48727769 CAGGGCCTCCTGGAGAAGTGAGG + Intronic
1150453747 17:65290641-65290663 CAGTACCCGCTACAGTTGTGCGG - Intergenic
1151464600 17:74276390-74276412 CACTGCCCTCTGGAGTTTTGGGG - Intronic
1152071720 17:78137491-78137513 TGGCGCCCCCTGGAGGTGTGCGG - Intronic
1152438274 17:80289133-80289155 CAGTGCCCCCAGGAGGAGTTGGG + Intronic
1152557867 17:81063519-81063541 CAAGGCCCCGTGGGGTTGTGCGG + Intronic
1152625050 17:81384211-81384233 CTGTGCACCCTGGCGTTTTGGGG + Intergenic
1152693655 17:81733247-81733269 AACTGCCCCCTGGATGTGTGGGG - Intergenic
1155497593 18:26458111-26458133 GAGCGTCCCCTGGAGGTGTGTGG - Intronic
1157787685 18:50500362-50500384 CAGTTTCCCATGTAGTTGTGTGG + Intergenic
1160478084 18:79210703-79210725 CAGTGCACACTGGGGTTCTGTGG + Intronic
1160532741 18:79575117-79575139 CCGTGTCCCCTGGAGTGGTGCGG - Intergenic
1161010612 19:1957903-1957925 TAGGGCCCCCTGGAGCTGCGGGG + Intronic
1162320729 19:9969608-9969630 GAGGGCCCCCTGGACGTGTGGGG - Exonic
1162362855 19:10230303-10230325 CAGTGCCGCTTGGAGACGTGGGG - Intronic
1162567832 19:11454004-11454026 CAGTGCCCCCTGGTGGAATGCGG - Exonic
1163175355 19:15560934-15560956 CAGGGCCCCCTGGAGTAGGTGGG - Intergenic
1163297918 19:16424328-16424350 CAGTGGCCCCTGGTGGGGTGGGG - Intronic
1163453659 19:17393749-17393771 GAGGGAACCCTGGAGTTGTGTGG + Intergenic
1163472607 19:17506051-17506073 CCCTGGCCCCTGGAGTGGTGGGG + Exonic
1163772355 19:19198754-19198776 CAGGGCCCGCTGGAGTGCTGGGG - Intronic
1163832424 19:19553448-19553470 AAATGCCCCCTGGAGTCGTAGGG + Intergenic
1164787606 19:30946027-30946049 CAGTGCCCCTTTTAGTTTTGGGG + Intergenic
1165188489 19:34042107-34042129 CAGTGCCCCCTGCTGGTGAGTGG - Intergenic
1165742061 19:38210601-38210623 CGGAGCCCCCTGGAGATGTCTGG + Intergenic
1165931905 19:39364691-39364713 CAGTGCCAGGTGGAGTTGGGAGG + Intronic
1167341345 19:48918356-48918378 CAGTGCCGACTCCAGTTGTGAGG - Intronic
925901298 2:8511154-8511176 CCCTGCCCCCTGCAGCTGTGGGG + Intergenic
926373010 2:12199226-12199248 CAGTGCAACCTGGAATTCTGAGG + Intergenic
929788204 2:45006814-45006836 CAGGGTTCCCTGAAGTTGTGGGG + Intronic
931455258 2:62405133-62405155 AAGTGCCCCCGGGAGTGGTCAGG - Intergenic
933660841 2:84926027-84926049 CGGTGCTCCTTGGAGTTGAGCGG + Intergenic
933744176 2:85558598-85558620 CAGTGCCCCTGGGATTTGTAGGG + Exonic
933784414 2:85827565-85827587 CCGCGCCACCTGGTGTTGTGAGG - Intergenic
935929283 2:108105923-108105945 TTGTGCCCCCTGGACTTGTCTGG + Intergenic
937262472 2:120595389-120595411 CTGTGCTCCCTGGGGGTGTGGGG + Intergenic
947796657 2:232897299-232897321 CAGTGGGCCCTGGAGTGGTGGGG + Intronic
948829461 2:240591108-240591130 CAGAGCCCCCTTCAGTTCTGAGG + Intronic
948918154 2:241048727-241048749 CAGTGCCCCCTGGGATTCTTTGG + Exonic
949002866 2:241627493-241627515 CAGTGCCCGGTGGCGTTCTGTGG - Intronic
1170073680 20:12396106-12396128 TCATGCCCCCTGGAGTTGTGTGG - Intergenic
1171896954 20:30816321-30816343 CGGTGACGCCTGGAGTCGTGCGG - Intergenic
1173204288 20:40980392-40980414 CTGTGCTACCTGGAGTTGGGGGG + Intergenic
1175183174 20:57162545-57162567 CAACTCCCCCTGGGGTTGTGAGG + Intergenic
1175606767 20:60317661-60317683 CAGGGCCCTCTGGCTTTGTGTGG + Intergenic
1175872716 20:62216016-62216038 CAGTGCTCCAGGGAGCTGTGGGG + Exonic
1176243822 20:64087953-64087975 CAGTGCTCCCTGGGGTTGGCAGG - Intronic
1176371859 21:6067137-6067159 CAGTGACCCCTGCACTTGTTTGG + Intergenic
1176713413 21:10328259-10328281 CAGTGCCCCATGGAGGAGGGAGG + Intergenic
1178839258 21:36125699-36125721 CAGTGCCCCTTGTGGTTGAGTGG - Intergenic
1179560564 21:42213501-42213523 CAATGCCCAGTGGAGGTGTGGGG + Intronic
1179751660 21:43471402-43471424 CAGTGACCCCTGCACTTGTTTGG - Intergenic
1180829794 22:18898838-18898860 CAGTGCCCCATGGAGGAGGGAGG + Intergenic
1180953885 22:19732756-19732778 GAGTGCTCCCTGGAGCTGTGGGG + Intergenic
1181760756 22:25057286-25057308 CAGTGCCACCTGGAGCTCCGGGG + Intronic
1181910142 22:26231977-26231999 CAGTGCCCCATGGAGTGCTGTGG - Intronic
1183759653 22:39804701-39804723 CAGTGACATGTGGAGTTGTGGGG - Intronic
1203279885 22_KI270734v1_random:124111-124133 CAGTGCCCCATGGAGGAGGGAGG + Intergenic
949533027 3:4976313-4976335 TAGCTCCCCCTGGAGTTGAGCGG + Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
955081022 3:55657949-55657971 CTGTGCTCCCTGGAGCTCTGAGG + Intronic
955205962 3:56896035-56896057 TGATGCCCTCTGGAGTTGTGTGG + Intronic
961332666 3:126152159-126152181 CAGTGGCCCCTGGGGTGGGGTGG - Intronic
961406741 3:126685054-126685076 CAGTGCCCAGTGGAAATGTGGGG + Intergenic
962221497 3:133568071-133568093 AACTGCCTCCTGGAGTTGTGAGG - Intergenic
963971294 3:151432078-151432100 AGGAGCCCTCTGGAGTTGTGTGG - Intronic
964386767 3:156155918-156155940 CCTTTCCCACTGGAGTTGTGTGG + Intronic
964622040 3:158728319-158728341 CAGTGACCCCTAGAATTGGGAGG + Intronic
964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG + Exonic
966692471 3:182755956-182755978 CAGTGCCTCCTGGAACTGGGAGG - Intergenic
969960530 4:10940431-10940453 CAGTGCCTAGTGGAGCTGTGAGG + Intergenic
970537226 4:17041964-17041986 TAGTGAGCCCTGGAGCTGTGGGG + Intergenic
971004293 4:22356750-22356772 CCGTGCCTCCTGGAGGGGTGTGG - Intronic
972313587 4:37903967-37903989 CCGTGCCCACTTGAGATGTGTGG - Intronic
973296334 4:48525427-48525449 CAGTGCCCCCTGCAGATGTGAGG - Intronic
976755935 4:88498026-88498048 CAGTGGCCCCAGGTGTGGTGTGG + Intronic
977290117 4:95156346-95156368 CACTGCCCCCTGGAGTATTCTGG - Exonic
978709049 4:111755135-111755157 GATTGCCCACTGGAGTTCTGGGG - Intergenic
979776278 4:124592246-124592268 CAGTGCCAACTGCAGTTCTGGGG + Intergenic
982127551 4:152197485-152197507 CAGTGTGCCCTGGTGATGTGGGG - Intergenic
983934962 4:173495614-173495636 CAATGCCTCCTAAAGTTGTGAGG - Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
986794570 5:11196783-11196805 CAGTGCCCCCTACAGTGGTGAGG - Intronic
988579764 5:32458743-32458765 CACTGCCTACTGGAGCTGTGAGG - Intergenic
990614495 5:57493607-57493629 TGATGCCCACTGGAGTTGTGTGG + Intergenic
990647859 5:57864689-57864711 CAATTCCCCTTGGAGTGGTGTGG - Intergenic
992910804 5:81394186-81394208 CAGTGCCCTCTGGAGCTGGGCGG - Intergenic
997963411 5:138338829-138338851 CAGTCTCCCCAGGAGGTGTGGGG + Intronic
998043895 5:138971084-138971106 CAGTGCCACATGGTGTGGTGAGG - Intronic
1000392400 5:160737983-160738005 CTGTGCCTGCTGGAGTTGTTAGG - Intronic
1000651392 5:163822483-163822505 CTGTGCACCCTGGGGTTGGGGGG + Intergenic
1001951177 5:175817712-175817734 CTTTGCCCTCAGGAGTTGTGCGG + Intronic
1002133890 5:177096725-177096747 CACTGCCCCCCAGAGCTGTGAGG + Exonic
1003137424 6:3444573-3444595 CACTGCCTCCTGGAGTTCTCAGG - Intronic
1004222190 6:13756554-13756576 CAGTGCCCACTGGATTTGGCTGG - Intergenic
1005270009 6:24153558-24153580 TGGTGCCTCCTGGAGGTGTGCGG - Intronic
1006789032 6:36686642-36686664 CAGAGCCACCTGGAGCTGAGAGG - Exonic
1013312914 6:108914401-108914423 CAGCGCCCCCTAGAGGTGGGGGG - Intronic
1015777762 6:136831982-136832004 CACTGCCTACTGGAGTTGTGAGG - Intronic
1019124952 6:169831810-169831832 CAGCGCCCCCTGCCGTGGTGTGG - Intergenic
1019142030 6:169954412-169954434 CAGTGCCTCCTGGAGTACTGAGG - Intergenic
1025694116 7:63766157-63766179 CAGGGCCACCGGGAGTTGGGCGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1026722575 7:72844832-72844854 CTGTGACTCCAGGAGTTGTGGGG + Intergenic
1026948049 7:74328552-74328574 CAGAGCCCCATGGGGTTGGGAGG + Intronic
1028638932 7:93021787-93021809 CAGTTCCCACTGGTTTTGTGTGG - Intergenic
1029381548 7:100218656-100218678 CAGTGTCACCTGGAGTTATAAGG - Intronic
1032093219 7:128922589-128922611 TAAGGCCCCCTAGAGTTGTGAGG + Intergenic
1033585909 7:142774158-142774180 CAGTGCCCCATGGAGAAGTGAGG + Intergenic
1034244008 7:149630849-149630871 CAGACCCCCTTGGAGCTGTGAGG + Intergenic
1034890023 7:154831340-154831362 CAGTGGCCCCTGGAGTAGGGAGG - Intronic
1035418725 7:158709722-158709744 CAGGGCCCTCTGGACTTCTGGGG + Intergenic
1035562567 8:617182-617204 CAGTGCCTCTTGGAATCGTGTGG - Intronic
1035568773 8:658981-659003 CAGTGCACACCGGAGATGTGGGG - Intronic
1038746815 8:30261899-30261921 CAGTGGCCCCTTGGGTTCTGAGG + Intergenic
1038779901 8:30561364-30561386 CAGTGCCATCTGGAGTTGTAAGG - Intronic
1039850897 8:41364195-41364217 CAGTGCACCCTGGAGTTGCAGGG + Intergenic
1040833437 8:51705166-51705188 CAGGGCCCCCTTCAGTTATGTGG - Intronic
1044710932 8:95057072-95057094 CAGCGCCCCCTAGAGTTCTGCGG - Intronic
1045052955 8:98343330-98343352 CAGTGGCACCTGGAGTGGTTCGG - Intergenic
1045104747 8:98881348-98881370 CAGTTGTTCCTGGAGTTGTGGGG + Intronic
1047480429 8:125276943-125276965 TGGCTCCCCCTGGAGTTGTGTGG + Intronic
1047527486 8:125645997-125646019 CTGGGCTCCCTGGAGTTGTACGG - Intergenic
1048801519 8:138198400-138198422 TAGTGCACCCTGCAGTAGTGGGG - Intronic
1049745778 8:144262746-144262768 CAGTGCACCCTGCAGGTGAGGGG - Intronic
1050052662 9:1619460-1619482 CAGTTCCACATGGAGTTGTGAGG + Intergenic
1052221401 9:26027850-26027872 CAGTGCCCTCTAGATATGTGAGG + Intergenic
1054336291 9:63813121-63813143 CGGTGACGCCTGGAGTCGTGCGG + Intergenic
1056268091 9:84919844-84919866 CAGTGCCTCATGAGGTTGTGAGG + Intronic
1056857621 9:90147644-90147666 CAGTGCTTGCTGGGGTTGTGGGG - Intergenic
1059172279 9:112136981-112137003 CAGTGTGCCCTGGAGATGGGAGG - Intronic
1185454978 X:304825-304847 GAGGGCCCACTGGAATTGTGTGG + Exonic
1195080195 X:101363287-101363309 CATTCCCTCATGGAGTTGTGAGG + Intronic
1195543298 X:106087379-106087401 AAGTACCCCCTGTAGTTCTGTGG - Intergenic
1198706151 X:139450682-139450704 CCCTGTCCCCTGGAGTTATGTGG - Intergenic
1198749069 X:139920797-139920819 AAGATCCCCCTGGAGCTGTGTGG + Intronic
1199027859 X:142961034-142961056 CACTGCCTACTGGAGTTGTGAGG - Intergenic
1200154517 X:153968352-153968374 CTGTGCCCCTTGCAGTTCTGCGG - Intronic