ID: 1076001289

View in Genome Browser
Species Human (GRCh38)
Location 10:126915050-126915072
Sequence TTTCCCACCCCACTTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076001289_1076001293 18 Left 1076001289 10:126915050-126915072 CCTGCAGCAAGTGGGGTGGGAAA 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1076001293 10:126915091-126915113 CTCGCAGGAAGAGGAGAATGTGG No data
1076001289_1076001290 3 Left 1076001289 10:126915050-126915072 CCTGCAGCAAGTGGGGTGGGAAA 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1076001290 10:126915076-126915098 AATCTGACTGTGTGCCTCGCAGG No data
1076001289_1076001295 27 Left 1076001289 10:126915050-126915072 CCTGCAGCAAGTGGGGTGGGAAA 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1076001295 10:126915100-126915122 AGAGGAGAATGTGGATTTGGTGG No data
1076001289_1076001294 24 Left 1076001289 10:126915050-126915072 CCTGCAGCAAGTGGGGTGGGAAA 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1076001294 10:126915097-126915119 GGAAGAGGAGAATGTGGATTTGG No data
1076001289_1076001291 9 Left 1076001289 10:126915050-126915072 CCTGCAGCAAGTGGGGTGGGAAA 0: 1
1: 0
2: 3
3: 19
4: 220
Right 1076001291 10:126915082-126915104 ACTGTGTGCCTCGCAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076001289 Original CRISPR TTTCCCACCCCACTTGCTGC AGG (reversed) Intronic
900638903 1:3678948-3678970 TTTCCCACCCCACATGCTCCTGG + Intronic
900837411 1:5015863-5015885 TTTCCTCTCCCACTTGGTGCTGG - Intergenic
901211028 1:7526235-7526257 TTTCCCACCCCAGGGGCTCCAGG + Intronic
902201495 1:14836702-14836724 TTTCCCTCCCCACATCGTGCAGG - Intronic
903754657 1:25652455-25652477 CTTCCCACCCCACAGGCTGGAGG + Intronic
905058978 1:35122962-35122984 TTTCCCACCACCCATGCTTCTGG - Intergenic
908754241 1:67453463-67453485 TTTCCCACTCCATTTTCTACTGG - Intergenic
910169589 1:84363108-84363130 GTTCCAAGCCCACGTGCTGCCGG - Intronic
913492529 1:119394410-119394432 TTTCCCAACCTACTGGCTGAGGG - Intergenic
915724528 1:158008148-158008170 CTCCCCACCCCCCTCGCTGCCGG - Intronic
915921279 1:159977654-159977676 TTTCCCTCCCCAGTTCCTGGTGG - Intergenic
917488588 1:175477961-175477983 TTTGCCACCCAACATGCTTCTGG + Intronic
917669893 1:177263479-177263501 TTTCCCACCCCTCATGCTCCTGG - Intronic
919609080 1:199722708-199722730 TTCCCCACCCCACTTTGTGTGGG - Intergenic
919616321 1:199813251-199813273 TTTCCAACCTCCCTTGCTGTTGG + Intergenic
920180794 1:204130683-204130705 TTCCCCACCCCACTGACAGCTGG + Intergenic
920377509 1:205517066-205517088 ATTCCCAGCCCACTGACTGCTGG - Intronic
920757601 1:208749104-208749126 TTCCCCACCCCCATTGCCGCTGG - Intergenic
922067218 1:222156046-222156068 TTTCCCAAACCTCTTCCTGCTGG + Intergenic
923746872 1:236709548-236709570 TGTCCCACCCCACAGGATGCAGG + Intronic
1062820968 10:534296-534318 CTTCCCACTCCTCTTCCTGCTGG + Intronic
1064425271 10:15224385-15224407 CTTCACACCCCATTTGCTGCAGG + Intronic
1065547994 10:26841588-26841610 ATTCCCCACCCACTTGCTCCTGG + Intronic
1065652873 10:27911852-27911874 TTTCCCACCACACTCCCAGCAGG + Intronic
1067087144 10:43248919-43248941 TTTTCCACAGCACTTGTTGCCGG - Intronic
1067376010 10:45727853-45727875 TTTCCCACCCCATTTAGTCCAGG - Intronic
1067519626 10:46987696-46987718 ATTCTCACCGAACTTGCTGCAGG + Intronic
1067642621 10:48064143-48064165 ATTCTCACCGAACTTGCTGCAGG - Intergenic
1067883710 10:50068541-50068563 TTTCCCACCCCATTTAGTCCAGG - Intronic
1068682662 10:59837301-59837323 CTTCCCACCCAACATGCAGCAGG + Intronic
1069415537 10:68197403-68197425 TTTCCGACCACATTTCCTGCAGG + Exonic
1070469697 10:76766588-76766610 TTGCCCCCCTCACTTGGTGCAGG + Intergenic
1070844551 10:79511545-79511567 TTTCCGAACCCACTTGCAGATGG + Intergenic
1074882158 10:117667732-117667754 TCTCCCACCCCAGTTTCTCCTGG + Intergenic
1076001289 10:126915050-126915072 TTTCCCACCCCACTTGCTGCAGG - Intronic
1076076656 10:127538780-127538802 CCTCCCATCCCACTTGCTTCTGG + Intergenic
1076853723 10:133105232-133105254 ATGCCCACACCACTTCCTGCCGG + Intronic
1077328496 11:1973837-1973859 CCTCCCACCCCACCAGCTGCAGG - Intronic
1078467119 11:11558647-11558669 TATCCCAGCCCTCTGGCTGCAGG - Intronic
1078757116 11:14221757-14221779 TTCCACACCCCACATGATGCAGG + Intronic
1082475348 11:53309213-53309235 TTTCCAAACCCACTTTCTGTAGG + Intergenic
1084312320 11:68324294-68324316 TATCCCACCCCACTAGGTCCCGG - Intronic
1084472157 11:69368812-69368834 TTCCCCACCCCACTCGCAGTGGG + Intergenic
1084565181 11:69924520-69924542 TTTCCCACCCCACCTGTTATAGG + Intergenic
1085787169 11:79463573-79463595 CCTCCCCACCCACTTGCTGCAGG + Intergenic
1086908808 11:92448716-92448738 TTTCCCAGCACACTTTCAGCAGG - Intronic
1087248224 11:95865667-95865689 TTTCCCACCCCAGGTCCTGAGGG - Exonic
1088302050 11:108368731-108368753 TTTCCCACCCTACTTTGTGCAGG + Exonic
1088795731 11:113265405-113265427 TTTCCCCTCCCACTGCCTGCTGG - Intronic
1089253270 11:117179971-117179993 CTTCCCACCCAACTTGCAGTTGG - Intronic
1090981461 11:131726153-131726175 TCTCCCACTCTACCTGCTGCTGG + Intronic
1202811474 11_KI270721v1_random:29016-29038 CCTCCCACCCCACCAGCTGCAGG - Intergenic
1091660678 12:2380956-2380978 CTCCCCATCCCACGTGCTGCTGG - Intronic
1092399563 12:8162844-8162866 TTAATCACCCCACTTGCTCCTGG + Intronic
1094379389 12:29826748-29826770 TTACCCACCCCATTTTCTGCGGG + Intergenic
1094468790 12:30782937-30782959 CTTCCCACACCAATTGCTCCTGG + Intergenic
1095160119 12:38905777-38905799 TTTCCCAGCCCCCTTCCGGCAGG + Intronic
1096004350 12:48157109-48157131 ATCCCCACCGCACCTGCTGCGGG + Intronic
1096243082 12:49969753-49969775 TTTCCATCCCCACTTGCCACTGG - Intronic
1096382738 12:51172828-51172850 TTTCCCCCGCCCCTTTCTGCTGG + Exonic
1096774981 12:53958072-53958094 CTTCTCACCCCTCTTGCTCCTGG - Exonic
1097083847 12:56453253-56453275 TGTCCCTCTCCACTTGCTGCTGG - Intronic
1099742965 12:86665230-86665252 TTTTCCACCTCACTTGGGGCTGG - Intronic
1101350339 12:103924517-103924539 TTTCCCACGCCTCTTCCTCCTGG - Intergenic
1102967683 12:117140911-117140933 TTTCACACTCCACTTCCTGCTGG - Intergenic
1103209136 12:119154136-119154158 TTTCCCACCCCACTGGGTCACGG - Intronic
1104606474 12:130193184-130193206 TTTCCCTTCCCCCTTCCTGCTGG - Intergenic
1104798452 12:131536570-131536592 TTTCCCACCACAGGTGCTGGGGG + Intergenic
1104969980 12:132526852-132526874 TTCCCCACCCCTCCTGCTGGGGG + Intronic
1104976526 12:132554364-132554386 TTTCAGACCCCAGTTTCTGCCGG - Intronic
1105213411 13:18271122-18271144 TTCCACACCCCTCTTTCTGCAGG + Intergenic
1106127347 13:26911295-26911317 TCTCCCTCACCACTCGCTGCAGG - Intergenic
1106581339 13:31021088-31021110 TTTCCCAGCCCACTTCTTTCTGG + Intergenic
1108313916 13:49220240-49220262 TTTCCCAGCCCGCACGCTGCGGG - Intergenic
1111224277 13:85249070-85249092 TTATCCACCCTTCTTGCTGCGGG + Intergenic
1113067568 13:106387683-106387705 GTTCCCACCCCACTAGCAGAGGG - Intergenic
1113599966 13:111561569-111561591 CTTCCCACCCCCGGTGCTGCTGG - Intergenic
1114379928 14:22191919-22191941 TTTCTCAGCCCACCTTCTGCTGG - Intergenic
1114819285 14:25997069-25997091 CATCCCACCCCACATGATGCAGG + Intergenic
1118887609 14:69879705-69879727 GCTCACGCCCCACTTGCTGCTGG + Exonic
1121086012 14:91146585-91146607 TGTCCCACTCGTCTTGCTGCAGG - Intronic
1121453336 14:94023233-94023255 TTCCCCACCCCACCAGCTGCGGG - Intergenic
1121977731 14:98421355-98421377 TTTCCCAGTACACATGCTGCTGG - Intergenic
1122016826 14:98803497-98803519 CTGCCCACCCCTCCTGCTGCAGG + Intergenic
1122780854 14:104142856-104142878 TCCCACACCCCACTTGCTGGTGG + Intronic
1122918245 14:104868624-104868646 GTGCCCACCCCACTTGCTGCAGG + Intronic
1124588646 15:31034393-31034415 TTGCCCACCCCATCTGCTGCAGG + Intronic
1124997752 15:34740264-34740286 TTTCCAACCCCACATGTTACAGG - Intergenic
1126319241 15:47404427-47404449 TTTCCAGCTCCAGTTGCTGCTGG + Intronic
1128112075 15:65082755-65082777 AGCCCCACCCCACTTCCTGCAGG + Intergenic
1131872942 15:96779622-96779644 TTTCCCAGCCCACCTGCCGGGGG + Intergenic
1132855530 16:2042983-2043005 CTCCCCACCCCACCTGCTGAGGG + Intronic
1133134334 16:3699211-3699233 CTTCCCATCCGAGTTGCTGCAGG + Intronic
1135037396 16:19089621-19089643 TTTCCCACTCCACCTGCTGCAGG - Intergenic
1135511875 16:23092297-23092319 GTTCCCACCCCAGTTGCTTAGGG - Intronic
1136516090 16:30769164-30769186 TGTCTCTGCCCACTTGCTGCAGG + Exonic
1140297514 16:73723843-73723865 TTCCTCACCCTTCTTGCTGCTGG - Intergenic
1141033400 16:80608660-80608682 TTTTCCACCACACCTGCAGCTGG - Intronic
1142852092 17:2709249-2709271 TTTCGGACCCTACTTCCTGCTGG - Intronic
1143885047 17:10059120-10059142 TTTCCCATCCCACTTTCCCCAGG + Intronic
1146109009 17:30070047-30070069 TTTCCCATCCCAGTAGCTTCAGG + Intronic
1146990034 17:37261535-37261557 TTTCACAACCCACTTCCTGCTGG - Intronic
1147330203 17:39694757-39694779 TTGCTCACTCGACTTGCTGCTGG - Intronic
1147666795 17:42154129-42154151 TTCCCCTCCCCCCTTGCTCCAGG - Intronic
1148578326 17:48726650-48726672 CTTCCCAGGCCACTGGCTGCTGG - Exonic
1149281309 17:55108437-55108459 TTTCACACCCCAATGGCAGCTGG - Intronic
1149667790 17:58377951-58377973 TTTCCCACCCCCATATCTGCAGG - Intronic
1151538825 17:74753831-74753853 TTTCCCACCCCACTTTCCCAGGG - Intronic
1151653961 17:75486805-75486827 TACCCCACCCCAATTCCTGCAGG - Intronic
1151941986 17:77298478-77298500 TTCCCCACCGCAGCTGCTGCAGG + Intronic
1152261554 17:79269938-79269960 GTCCCCACCCCAGATGCTGCAGG - Intronic
1153725401 18:7949159-7949181 CTCCCCACCCCACTTGATACAGG + Exonic
1154382413 18:13864352-13864374 TCTCCCACCCCACATCCTGTGGG - Intergenic
1155517883 18:26641160-26641182 TTTCCCAACCCACTGGCCACTGG + Intronic
1156223524 18:35078915-35078937 TTCCCCACTCTACTTGCAGCAGG - Intronic
1157430642 18:47621650-47621672 TTTCCCACCCCTCTGGCTAGAGG - Intergenic
1158744026 18:60176836-60176858 CTTCCCATCCCGCTTTCTGCAGG - Intergenic
1159501712 18:69279826-69279848 TTTACAAACCCATTTGCTGCTGG + Intergenic
1159656626 18:71036525-71036547 TTTACCACCCCTCTTGGGGCAGG - Intergenic
1159895584 18:73992615-73992637 ATTCCAACCCCAACTGCTGCTGG + Intergenic
1161370295 19:3907633-3907655 TCTCCCACCTCCCTCGCTGCCGG - Intronic
1162396768 19:10421593-10421615 TTTCTGACCCCAGCTGCTGCAGG - Intronic
1163224644 19:15949498-15949520 TTTTCCACCTCACTTTCTGTGGG + Exonic
1163833920 19:19562168-19562190 CTACCCAGCCCACGTGCTGCAGG + Intronic
1165122269 19:33567716-33567738 CTTCCCACCACAGTTGCTGCAGG - Intergenic
1167589865 19:50398690-50398712 GCTCCCACCCCACTGCCTGCAGG + Intronic
926297270 2:11577904-11577926 TTCCCCACCTCACTGGCCGCTGG + Intronic
927517914 2:23682744-23682766 GCTCCCACCCCCCTTGCTCCGGG + Intronic
934300912 2:91775622-91775644 TTCCACACCCCTCTTTCTGCAGG - Intergenic
934518584 2:95005103-95005125 TTTCCCAGGCGCCTTGCTGCTGG - Intergenic
940996704 2:160157502-160157524 TTCCCACCCTCACTTGCTGCTGG - Intronic
943648547 2:190432278-190432300 TTCCCCATCCCACTTTCTTCAGG - Intronic
945668946 2:212779046-212779068 TTCCTCACCCCACTTCCTTCAGG + Intergenic
946827093 2:223690279-223690301 TATCCCACCCCACCCGCTACTGG + Intergenic
947364646 2:229381388-229381410 TTTCCTACCCCAGTGGCTCCTGG + Intronic
947852191 2:233297302-233297324 CTTCCCAGCCAACTTGCTCCTGG - Intergenic
948420397 2:237856565-237856587 TTTCCCACCCATCTTCCTCCAGG + Intergenic
948760645 2:240188453-240188475 TTACCCACACCACGTGCTCCTGG - Intergenic
1168799346 20:634374-634396 TCTCTGAGCCCACTTGCTGCTGG - Intergenic
1169061592 20:2664193-2664215 CTTCCCACGCGACTTCCTGCGGG - Exonic
1169213921 20:3783141-3783163 TTTCCCACCTCACCTGAGGCTGG - Intergenic
1170580284 20:17693974-17693996 GTTCCCACCCCAGTGGCTGAAGG - Intronic
1173914014 20:46693191-46693213 CTTCCCATCCCCCTTCCTGCTGG - Intergenic
1174063613 20:47849353-47849375 CTCCTCACCCCACTCGCTGCAGG - Intergenic
1176626005 21:9092396-9092418 CTACCAACCTCACTTGCTGCCGG - Intergenic
1178089504 21:29146603-29146625 TTTCCCAAGCCCCTTGCTGCAGG - Intronic
1178600297 21:33988664-33988686 TTTCCAGCCTCCCTTGCTGCCGG - Intergenic
1179313915 21:40223932-40223954 TACCCCACCCCACATGCTGTGGG + Intronic
1179885206 21:44310936-44310958 GCTCCCAGACCACTTGCTGCCGG + Intronic
1179919469 21:44499748-44499770 CTGGCCACCCCAGTTGCTGCCGG + Exonic
1180816243 22:18791522-18791544 TTCCACACCCCTCTTTCTGCAGG + Intergenic
1181202432 22:21225854-21225876 TTCCACACCCCTCTTTCTGCAGG + Intronic
1181699274 22:24610760-24610782 TTCCACACCCCTCTTTCTGCAGG - Intronic
1183625887 22:39001368-39001390 TCTCCCCCCTCAGTTGCTGCAGG - Intergenic
1184138332 22:42562440-42562462 GTTCCCACCTCTCTGGCTGCTGG + Intronic
1185137262 22:49080013-49080035 TTTCTGCCCCCACGTGCTGCAGG - Intergenic
1203224481 22_KI270731v1_random:69559-69581 TTCCACACCCCTCTTTCTGCAGG - Intergenic
1203266346 22_KI270734v1_random:17233-17255 TTCCACACCCCTCTTTCTGCAGG + Intergenic
950406406 3:12807905-12807927 TTTCCTGCCTCCCTTGCTGCTGG - Intronic
950427616 3:12932961-12932983 TCTTCCTCCCCGCTTGCTGCTGG + Intronic
951213886 3:20005817-20005839 CTTCCCACCCCACTTGAACCCGG + Intronic
952068442 3:29602083-29602105 TTTCATACTCCTCTTGCTGCGGG + Intronic
954384510 3:50237165-50237187 TAGCCCAGCCCACTTGGTGCAGG - Intronic
955187365 3:56727544-56727566 TTTCCCAACACACTGGCTGATGG + Exonic
955821551 3:62901291-62901313 TTTCACATCCCTCTTGCTTCTGG - Intergenic
958540509 3:95464894-95464916 TTGGCCACGCTACTTGCTGCAGG + Intergenic
961390452 3:126549681-126549703 GTTCCCACCCCACTTCCAGCTGG - Exonic
962888234 3:139647992-139648014 TCTCCTATTCCACTTGCTGCAGG - Intronic
963615036 3:147525939-147525961 TTACCCAACCCACAGGCTGCAGG - Intergenic
965545260 3:169909066-169909088 TCACCCACCCCAGTTGCTCCTGG - Intergenic
965610983 3:170543689-170543711 TTTCCCAACCCTCTTGGTCCTGG - Intronic
967592645 3:191296677-191296699 TTTCAAACCCCACCTGCTGGAGG + Intronic
967756537 3:193176541-193176563 TTTCCCACCCCACTAACTGAAGG - Intergenic
968555925 4:1246424-1246446 TTTCCCACTCCACTGGGGGCTGG - Intronic
969608766 4:8215760-8215782 TTTCAGACCCACCTTGCTGCTGG + Intronic
969780523 4:9398759-9398781 TTAATCACCCCACTTGCTCCTGG - Intergenic
971236311 4:24845281-24845303 CTTCCCACCACACTTCCTTCAGG + Intronic
972065057 4:34932266-34932288 TTACCCACCCATATTGCTGCAGG - Intergenic
972275602 4:37554702-37554724 TTTCACACACCACTTTCTCCAGG - Intronic
977074333 4:92433574-92433596 ATTCTCTCCCCACCTGCTGCTGG + Intronic
978386756 4:108183529-108183551 TTTCACACCCCACATGCTGTAGG - Intergenic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
979671667 4:123366150-123366172 TTTCCCACCCCAATCGCCTCAGG + Intergenic
985623932 5:974387-974409 CTTCCCATCGCACCTGCTGCAGG - Intergenic
988702399 5:33688491-33688513 TTTCCTTCCCCACATACTGCAGG + Intronic
988736027 5:34022320-34022342 TCTCACAGCCCACTTCCTGCTGG - Intronic
988916840 5:35903108-35903130 ATGCCCACCCACCTTGCTGCTGG - Intergenic
992896000 5:81245697-81245719 TTTCCCATCCCGCTGGCTCCTGG - Intronic
992945136 5:81802413-81802435 TTTCCTACCTCACTTGCTTTAGG - Intergenic
996252981 5:121360581-121360603 TTTCCCAGCCCACTTTATGTTGG + Intergenic
996669451 5:126100367-126100389 TTTCCAACCCCCCTTGCAGGTGG - Intergenic
997109703 5:131061334-131061356 CTTCCCTCCCCACCTGCTTCTGG - Intergenic
997454994 5:134010138-134010160 TATTCCACCCCCCTTGATGCTGG + Intergenic
997763864 5:136479402-136479424 GCTCCCACCTCACTTCCTGCAGG - Intergenic
998514171 5:142737723-142737745 TCTCCCACCCCATTTTCTCCTGG - Intergenic
998830253 5:146150081-146150103 TTTCTAACCCCACCTGCTGCAGG + Intronic
1000273774 5:159713272-159713294 TTTCCCAACCCACTAGCCTCAGG + Intergenic
1001134413 5:169090511-169090533 TTTCCCACCCCACCTCAGGCTGG + Intronic
1001936926 5:175711996-175712018 TGTCCACCCCCACCTGCTGCAGG - Intergenic
1004254530 6:14050751-14050773 TGTGCCACCCCACAAGCTGCTGG - Intergenic
1005648575 6:27865591-27865613 TATCCCGCGCCACTTGCAGCTGG + Exonic
1007287554 6:40758497-40758519 TTTCCCAGCCGTCTTGCAGCTGG + Intergenic
1007317874 6:41003967-41003989 TTTCCTACCCCACTTCTTACAGG + Intergenic
1009846357 6:69140515-69140537 TTAACCACCCCACTTCCTCCTGG - Intronic
1017011654 6:150067764-150067786 TTTCCAACCACACATGCTTCTGG - Intronic
1017331846 6:153208533-153208555 TTTCCCACCCCACTAACTTAAGG - Intergenic
1021792251 7:24217555-24217577 TCTCCCATCCCACATGCTCCTGG + Intergenic
1021970876 7:25964813-25964835 TTTGCAACCCGCCTTGCTGCTGG - Intergenic
1023636178 7:42213080-42213102 TTTCCCTCCCCACATGGTGACGG - Intronic
1024310233 7:47962354-47962376 TTTCCCATTCCAGTTGCTCCTGG - Intronic
1029005246 7:97202359-97202381 TGTCCCAGCACACATGCTGCTGG + Intergenic
1029401263 7:100348155-100348177 TTCCCCAGACCATTTGCTGCTGG - Intronic
1033595282 7:142854802-142854824 CTTCCCTTCCCACTTCCTGCAGG + Intergenic
1034204339 7:149302576-149302598 AATACCACCCTACTTGCTGCTGG + Intergenic
1035601237 8:898034-898056 TTTTCCAACCCACTTACTGCAGG - Intergenic
1036277955 8:7372699-7372721 TTAATCACCCCACTTGCTCCTGG - Intronic
1036343568 8:7939193-7939215 TTAATCACCCCACTTGCTCCTGG + Intronic
1036838912 8:12099962-12099984 TTAATCACCCCACTTGCTCCTGG + Intergenic
1036860701 8:12346205-12346227 TTAATCACCCCACTTGCTCCTGG + Intergenic
1041708933 8:60875683-60875705 TTACCGTCCCCACTTGGTGCAGG - Intergenic
1045182029 8:99794617-99794639 TTTCCCAGCCTGCTTTCTGCTGG + Intronic
1047448371 8:124939615-124939637 TTTCCAGCCTCCCTTGCTGCTGG + Intergenic
1047664390 8:127074824-127074846 ATTCCCATCTCACCTGCTGCGGG + Intergenic
1048306543 8:133288667-133288689 CTTGCCACCCCACCTGCTGGAGG - Intronic
1049421904 8:142520716-142520738 AGCCCCACCCCACTTCCTGCAGG - Intronic
1055529614 9:77171016-77171038 TTTCCCACCCCACTCCATCCTGG + Intergenic
1057314369 9:93959120-93959142 TTTCCGCTCCCACTTGCAGCGGG + Intergenic
1057544356 9:96006352-96006374 TTTCCCACCTCATCTGCTTCTGG - Intronic
1059657211 9:116367780-116367802 TTTCCCTCCCCCTTAGCTGCAGG - Intronic
1060097534 9:120805535-120805557 TTTCCCACCTCACTAGTAGCTGG + Intergenic
1060527489 9:124328616-124328638 TCTCACACCCCGCTTGCCGCAGG - Intronic
1061580247 9:131531639-131531661 CCTCCCACCCCACCCGCTGCTGG + Intergenic
1062125411 9:134858096-134858118 ACTGCCACCCCACTTGGTGCAGG + Intergenic
1187319350 X:18226340-18226362 TTTCCCTCCCCACTTGCTCGAGG - Intergenic
1188767556 X:34114452-34114474 TTACCCACCCCACTTCCTCAAGG - Intergenic
1189130902 X:38497006-38497028 ATTCCCAGCCACCTTGCTGCTGG + Intronic
1189268284 X:39732973-39732995 GTTCCCAGGCCACTGGCTGCAGG + Intergenic
1190445437 X:50519347-50519369 TTTCCCACAACAGTTGCTGCAGG + Intergenic
1195230105 X:102838379-102838401 TTTTGCACCCCACTTGCTGAGGG - Intergenic
1195343645 X:103927480-103927502 TTCCCTTCCCCACTTGCTGGAGG + Intronic
1195421487 X:104679959-104679981 TTGCCCACCCCATTTTCTGATGG - Intronic
1199545529 X:149004308-149004330 TATCCCACCCACCTTTCTGCGGG + Intergenic
1199852756 X:151737173-151737195 TTTCCCACAGCCCATGCTGCTGG - Intergenic