ID: 1076003707

View in Genome Browser
Species Human (GRCh38)
Location 10:126931584-126931606
Sequence GGCCCCACCCCAACCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076003707_1076003710 -7 Left 1076003707 10:126931584-126931606 CCCACTGGGGTTGGGGTGGGGCC 0: 1
1: 0
2: 2
3: 57
4: 381
Right 1076003710 10:126931600-126931622 TGGGGCCTCATCTGTTGAATGGG No data
1076003707_1076003711 -6 Left 1076003707 10:126931584-126931606 CCCACTGGGGTTGGGGTGGGGCC 0: 1
1: 0
2: 2
3: 57
4: 381
Right 1076003711 10:126931601-126931623 GGGGCCTCATCTGTTGAATGGGG No data
1076003707_1076003709 -8 Left 1076003707 10:126931584-126931606 CCCACTGGGGTTGGGGTGGGGCC 0: 1
1: 0
2: 2
3: 57
4: 381
Right 1076003709 10:126931599-126931621 GTGGGGCCTCATCTGTTGAATGG No data
1076003707_1076003712 -3 Left 1076003707 10:126931584-126931606 CCCACTGGGGTTGGGGTGGGGCC 0: 1
1: 0
2: 2
3: 57
4: 381
Right 1076003712 10:126931604-126931626 GCCTCATCTGTTGAATGGGGTGG No data
1076003707_1076003714 10 Left 1076003707 10:126931584-126931606 CCCACTGGGGTTGGGGTGGGGCC 0: 1
1: 0
2: 2
3: 57
4: 381
Right 1076003714 10:126931617-126931639 AATGGGGTGGTCGACTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076003707 Original CRISPR GGCCCCACCCCAACCCCAGT GGG (reversed) Intronic
900132170 1:1091807-1091829 CGCCCCACCCCATCTCCATTTGG - Intronic
900549564 1:3247508-3247530 AGCCCCGCCCCCACCCCAGGAGG + Intronic
900970001 1:5986747-5986769 CGCCCCACCCCTACCCCCGTGGG + Intronic
901036292 1:6338247-6338269 GGCTCCACCCCCAGCACAGTCGG + Intronic
901237852 1:7677042-7677064 GGCCCCAGCTCAGCCCCAGTGGG - Intronic
901613241 1:10516384-10516406 GGTCCCACAGCAAACCCAGTGGG - Intronic
901638401 1:10680860-10680882 GGCCCCAGCCCTGCCCCAGTGGG - Intronic
902372405 1:16014840-16014862 GCCCCACCCCCAACCCCACTTGG + Exonic
902446158 1:16465915-16465937 GGCCCCACCCTAAATCCAGGAGG + Intergenic
902598527 1:17525348-17525370 GTCCCATCCCCCACCCCAGTTGG - Intergenic
902728400 1:18352404-18352426 GACCCCACCCCATCCCAGGTTGG + Intronic
903231137 1:21922959-21922981 GCCCCCACCCCGACCCCAGAAGG + Intronic
903385640 1:22924502-22924524 GACCCCACCCCCACCCCCATGGG + Intergenic
904038913 1:27573124-27573146 ATCCCCACCCCACCCCCAGAAGG - Intronic
904285614 1:29451669-29451691 TCCCCCTCCCCACCCCCAGTGGG + Intergenic
904419809 1:30384356-30384378 TCCCCCTCCCCACCCCCAGTGGG - Intergenic
905174754 1:36128265-36128287 GGCGCCTCCCCAACCCCAAGGGG + Intergenic
905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG + Intergenic
905447927 1:38039291-38039313 GGCCCCACTTCACCCACAGTGGG - Intergenic
905827114 1:41034229-41034251 CCCCCCACCCCAACCCGAGCAGG - Intronic
906636934 1:47416224-47416246 GGCCCCCCCCCAACCACCGCCGG - Exonic
907440329 1:54474822-54474844 GGCCCCAAGCCCACCCCAGCTGG - Intergenic
908444559 1:64188841-64188863 GGTCCTACCACAACCCCAATGGG + Intergenic
908769229 1:67581257-67581279 CTCCCCTCCCCCACCCCAGTTGG - Intergenic
910449532 1:87331562-87331584 GGCCCCTCCCCAGCCCCCGCCGG - Intronic
912172855 1:107121762-107121784 AGCCCCACCCCACCCCAATTGGG + Intergenic
912474412 1:109926578-109926600 TGCCCCCCGCCAACCCCAGCTGG + Intronic
913084387 1:115423392-115423414 GGCGCCACCCCAACAGCAGGTGG + Intergenic
915296473 1:154925079-154925101 AGCCCCACCCCCACCTCAGCAGG + Exonic
917853792 1:179085900-179085922 GGCCTCACCCCAGCCCTGGTCGG - Intronic
917969057 1:180195689-180195711 GAGCCCACCCCTACCCCAGAGGG + Intronic
919744422 1:200999813-200999835 GGGCCCCCGCCAACCCCAGCAGG + Intronic
919788354 1:201274627-201274649 GGCCCAGCCCCAACCCCAGCAGG + Intergenic
919800389 1:201350567-201350589 GGCCCCATGCCCACCCCAGCAGG - Intergenic
920795298 1:209131089-209131111 GCCCCCGCCCCGACCCCCGTCGG - Intergenic
922565179 1:226597004-226597026 GGCCACTCCCCACCCCCAGGAGG - Intronic
923546988 1:234930305-234930327 AGCCCCACCCCAAACCCATGGGG - Intergenic
924673008 1:246147993-246148015 GGCTCGGCCCCAACCCCGGTCGG - Intronic
1062888357 10:1036642-1036664 GTCCCCACCCCCACCCCACGGGG - Intergenic
1066649387 10:37640391-37640413 GGATTCACCCCAACCCCAGCAGG + Intergenic
1066708021 10:38202370-38202392 TGCCCCATCCCATCCCCAATAGG + Intergenic
1067558456 10:47288148-47288170 GGCCCCACCCCAACTCAGGATGG + Intergenic
1067568655 10:47355873-47355895 CGCCCCTCACCAACCCCAGTGGG + Intronic
1067683594 10:48454825-48454847 GGCCCCTCCCCCACCCAAGCAGG + Intronic
1069330203 10:67283029-67283051 GGCCCCATCCCACACCCAGAAGG + Intronic
1070505385 10:77108190-77108212 TGCCCCTCCCCAACCCCACCGGG - Intronic
1071833449 10:89395177-89395199 GACCCCACCCCCACCCCACATGG + Intronic
1072365911 10:94709309-94709331 GGAACCACCTCAACCCCACTGGG - Intronic
1073006787 10:100330648-100330670 GTCCCCACCCCAATCCATGTCGG - Intergenic
1073300367 10:102467615-102467637 GTCCCCACCACCACCCCCGTGGG - Intronic
1074059565 10:109952544-109952566 GGACTCACCCCAACCCCATATGG - Intronic
1074490547 10:113935698-113935720 GGGCCCACCCCTAATCCAGTAGG + Intergenic
1074722071 10:116272389-116272411 GGACCCACCCCCACCCAGGTCGG + Intronic
1075425250 10:122337074-122337096 GGGCCCAGCCCTTCCCCAGTGGG - Intronic
1076003707 10:126931584-126931606 GGCCCCACCCCAACCCCAGTGGG - Intronic
1076426290 10:130369833-130369855 GGCACCATCCCCACCCCAGCTGG + Intergenic
1076613239 10:131739085-131739107 TGCCCCACCCCCACCCCACCAGG + Intergenic
1081765361 11:45606584-45606606 TGCCCCACCCCACCCCTAGCAGG + Intergenic
1081854550 11:46295428-46295450 GGCCCCGCCCCCACCCCCGCAGG - Intronic
1081860785 11:46332505-46332527 GCCCCTTCCCCAAACCCAGTGGG + Intergenic
1083263425 11:61535389-61535411 GGCCCACCCCCACCCCAAGTGGG - Intronic
1083297946 11:61725338-61725360 CCCCCAACCCCATCCCCAGTGGG - Intronic
1083681412 11:64353506-64353528 GGCCCCACCCCGCTCCCAGGCGG - Intronic
1083758168 11:64802358-64802380 TCCCCCACCCCTACCCCACTGGG - Intronic
1083861780 11:65423822-65423844 CGCCCCACCCCAGCCTCAGCGGG - Intergenic
1084105249 11:66976509-66976531 GGCCCCTACCCAAGCCCAGAGGG - Exonic
1084122562 11:67077995-67078017 CCCCCCACCCCGACCCCAGGTGG - Intergenic
1084574712 11:69981712-69981734 AGCCCCACCCCAGCCCCTGCAGG + Intergenic
1086455292 11:86954772-86954794 GCCCCCACCCCCACCCCTGGCGG - Intronic
1088733597 11:112706514-112706536 GACCCCACCACAACCCCAGAAGG - Intergenic
1089060565 11:115622868-115622890 GACCCCACCCCAACACCATTTGG - Intergenic
1089502496 11:118940712-118940734 GACCACCCCCCAACCCCAGGAGG + Intronic
1089648327 11:119894943-119894965 AGCCCCACCCCGACCCTTGTGGG + Intergenic
1090243343 11:125199184-125199206 TGCCCCAGCCCAGCCCCAGGTGG + Intronic
1090413678 11:126526500-126526522 GGCCCCAGGCCCACCCCAGGAGG + Intronic
1091796139 12:3298395-3298417 GGCCCCACCCCAACCTAAGCGGG - Intergenic
1091959706 12:4682952-4682974 CACCCCACCTCCACCCCAGTAGG - Intronic
1092113883 12:5984992-5985014 GGCCCAACCCTAGCCCCAGGGGG - Intronic
1093741339 12:22693126-22693148 TCCCCCACCCCAAACCCCGTGGG - Intergenic
1096257974 12:50074311-50074333 GCCCCAGCCCCAACCCCAGGAGG - Intronic
1096476493 12:51912312-51912334 GGCCCCGCCCCAAAGCCAGGCGG + Intronic
1096796596 12:54081826-54081848 CGCCCCAACTCAACCCCAGCAGG - Intergenic
1097233314 12:57524986-57525008 GGCCCCACCCCAGCCCCACCCGG - Exonic
1097575109 12:61382701-61382723 GGCCCCATCCTCACCCCAGGAGG + Intergenic
1097906028 12:64920417-64920439 AGCCCTACCCCAAACCCACTGGG - Intergenic
1100394613 12:94173924-94173946 GGCCCCAGCTTTACCCCAGTGGG + Intronic
1101407173 12:104438899-104438921 GGCCCCGCTCCAACCCAAGCAGG + Intergenic
1101414609 12:104498318-104498340 TGCCCCACCCCCAGCCCAGGAGG - Intronic
1102260029 12:111437940-111437962 GTGCCCACCCCAACCCCAAGAGG + Intronic
1102328062 12:112006074-112006096 GGCTCCACCCCTATCCCAGCTGG + Intronic
1102825286 12:115943627-115943649 GGCCCCACGCCAAGCCCATGGGG + Intergenic
1102933933 12:116881522-116881544 GCCCCCCCCCCAACCCCCGGGGG - Intergenic
1103425987 12:120834373-120834395 GAGCCCACTCCAACCCCTGTTGG - Intronic
1103907379 12:124334668-124334690 AGCCCCTCCCCACCCCCAGAAGG - Intronic
1105020962 12:132816677-132816699 GATCCCACCACAAGCCCAGTGGG - Exonic
1106228090 13:27800049-27800071 GGCCCCACTCCTAATCCAGTTGG + Intergenic
1106443390 13:29801026-29801048 GCCCCTACCCGAACACCAGTGGG + Intronic
1107654151 13:42574456-42574478 GGCCCAGCCCCAGCCCCAGGAGG - Exonic
1108613309 13:52105697-52105719 GGCCCCACCCAACCCCCAGGTGG - Intronic
1109124891 13:58505515-58505537 CCCCCCACCCCGCCCCCAGTGGG - Intergenic
1109837318 13:67877235-67877257 AGCCCCACCCCCAACCAAGTTGG + Intergenic
1113447077 13:110377504-110377526 GTGCCCACCCCACCCCCACTGGG + Intronic
1113613088 13:111661809-111661831 GGCCTCACCCCCACCCCCGCGGG - Intronic
1113936918 13:113999711-113999733 AGCCCCACCCGGACCCCAGCCGG - Intronic
1115478889 14:33842440-33842462 TGACCTAACCCAACCCCAGTTGG - Intergenic
1116841799 14:49826308-49826330 GCCCCCACTCCCACCCCACTAGG + Intronic
1119203747 14:72778594-72778616 ATCCCCTCCCCGACCCCAGTCGG + Intronic
1119424512 14:74527086-74527108 GGCCCCAGCCCATCCCAAATGGG + Intronic
1121132896 14:91464833-91464855 TCCCCCACTCCCACCCCAGTTGG - Intronic
1121608571 14:95259640-95259662 GGCCCACCCCCACCCCCAGGTGG + Intronic
1122384292 14:101333507-101333529 AGCCCCTCCCCAACCCCATGTGG - Intergenic
1122409282 14:101517837-101517859 AGCCCCACCCCAACCCCAAAGGG + Intergenic
1122632469 14:103113228-103113250 GGCCCCACCCCAGGCCCAACTGG + Intergenic
1122703668 14:103607017-103607039 GGCCCCACCCCAAATCCAGGAGG - Intronic
1122924151 14:104892081-104892103 GGCCCCACCCCAAGCCTCCTCGG - Intronic
1123026231 14:105425666-105425688 ACCCCCACCCCCACCCCAGCTGG + Intronic
1123039319 14:105483926-105483948 TGCCGCACCCCAGCCCCTGTGGG + Intergenic
1124412829 15:29451187-29451209 GGCCCCACCCCAATCCCTATGGG + Intronic
1127376830 15:58392784-58392806 GGCCCTGCCCCAAACCCAGAAGG - Intronic
1132079954 15:98855157-98855179 CTCCCCACCCCAACCACAGGAGG - Intronic
1132339408 15:101068609-101068631 GGTCCCAACCCCACCCGAGTGGG + Intronic
1132357702 15:101185058-101185080 GGCACCACCCGAAGCCCATTTGG - Intronic
1132597988 16:761948-761970 AGCCCCACCCCTACCCCAGGAGG + Intronic
1132601581 16:775310-775332 GGTCCGGCCCCACCCCCAGTCGG - Intronic
1132639473 16:971082-971104 GGCCCCACCCACACCCCGGGAGG + Intronic
1132683645 16:1153534-1153556 GGCCCCACCCCCACCCCGAGGGG - Intronic
1132789639 16:1678436-1678458 AACCCCACCCCAACCCCACACGG - Intronic
1132870116 16:2112181-2112203 GGCCCCTCCCTCACCCCAGTAGG + Intronic
1133033033 16:3020696-3020718 AGACCCCCCCCAACCCCAATTGG - Intronic
1134522429 16:14924775-14924797 GGCCCCTCCCTCACCCCAGTAGG - Intronic
1134683692 16:16144144-16144166 GGCCCCAACCCAACCACTGCGGG + Intergenic
1134710099 16:16323426-16323448 GGCCCCTCCCTCACCCCAGTAGG - Intergenic
1134717311 16:16363426-16363448 GGCCCCTCCCTCACCCCAGTAGG - Intergenic
1134949504 16:18345219-18345241 GGCCCCTCCCTCACCCCAGTAGG + Intergenic
1134957441 16:18388733-18388755 GGCCCCTCCCTCACCCCAGTAGG + Intergenic
1135323087 16:21509861-21509883 GGCCTCTCCCCAATCCCAATGGG + Intergenic
1135427378 16:22350252-22350274 AGCCCCACCCCAACAAGAGTTGG - Intronic
1136579569 16:31143253-31143275 GGCCCCAGCCCCTCCCCAGGGGG - Intronic
1136616471 16:31401476-31401498 GACCCCACCCTACCCCCAGTCGG - Intronic
1137573064 16:49579234-49579256 TGCCCCACCCCAGCCCCTGGTGG + Intronic
1137726024 16:50657353-50657375 AGCCCTACCCCAAGCCCAGCAGG + Intergenic
1138588448 16:57986127-57986149 GCGTCCACCCCCACCCCAGTGGG - Intronic
1138943174 16:61814870-61814892 GCCCCCACCTCCACCCCAGTTGG - Intronic
1139515025 16:67447605-67447627 GGCCCCACCCCCACCCCACAAGG - Intronic
1139630496 16:68229284-68229306 GGCTCCACACCAACCCCAGGCGG - Exonic
1139939186 16:70592208-70592230 GGCCCCAGCCCAGCCTCAGCCGG - Intronic
1140767890 16:78177012-78177034 GGCCCCACCCCAGACCTACTAGG + Intronic
1141430928 16:83969762-83969784 GCCCCCAGCCCCACCCCAGCAGG - Intronic
1141499235 16:84432069-84432091 GGCCCCACCCAGCCCCGAGTTGG - Intronic
1141617091 16:85216032-85216054 TGCCCCTCCCCAACTCCTGTTGG - Intergenic
1141642416 16:85348960-85348982 TGCCGCTCCCCAACCCCAGCCGG + Intergenic
1141680699 16:85542075-85542097 TGCCCCACCCCCACCCCATCCGG + Intergenic
1141730989 16:85822778-85822800 CGCCCCACCCCAACACCACTGGG + Intergenic
1142160467 16:88554901-88554923 GGCCCCACCCCCAGCCCAGCTGG + Intergenic
1142428181 16:90011746-90011768 GGCCCACCCCCAAGCCCAGCAGG + Intronic
1142733534 17:1879736-1879758 GACCACGCCCCAACCCCAGGAGG - Intronic
1142739110 17:1920252-1920274 AGCCCCAACCCAACCCCACTTGG - Intergenic
1142985469 17:3692465-3692487 GGCACCATCACAACCCCAGAGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143580789 17:7824452-7824474 ACCCCCACCCCAACACCAGGTGG + Intronic
1143680824 17:8474936-8474958 GGCCCCTCCCCATCGCCAGCCGG - Exonic
1143780235 17:9225448-9225470 GGCCCCCCGCCAGCCCCTGTGGG - Intronic
1144520126 17:15947649-15947671 AGCACCACCCCAACCCTGGTGGG + Intronic
1144741319 17:17584039-17584061 GGCCCCACACCCACCCCTGCTGG - Intronic
1145868135 17:28253701-28253723 GTGCCCACCCCAACCCCAGAAGG + Intergenic
1145961912 17:28891845-28891867 CGCTCCACCTCACCCCCAGTGGG + Intronic
1146415983 17:32633685-32633707 GCCCCCACCCCCATCCCAGAAGG + Intronic
1146727974 17:35171008-35171030 GCTCCCACCCCATCTCCAGTTGG + Intronic
1146911882 17:36653682-36653704 GGCCCCACCTCAAGGCCAATGGG - Intergenic
1147422279 17:40327860-40327882 GGCCCCCTCCCAACTCCTGTGGG - Intronic
1147655533 17:42088566-42088588 TCCCCCACCCCAACCTCAGCAGG + Intergenic
1147677509 17:42218393-42218415 AGCCCCACCCCCACCACAGAGGG - Intronic
1147688532 17:42301190-42301212 AGCCCCACCCCCACCACAGAGGG + Intronic
1147690240 17:42310357-42310379 GCCCCCACCCCACCCCAAGCTGG - Intronic
1147903148 17:43803748-43803770 GGCCCCACTCCAAACCCCCTAGG + Intronic
1148022279 17:44561351-44561373 TGCCCCACCCCCAGCCAAGTAGG - Intergenic
1148663943 17:49361391-49361413 AGCCCCACACTCACCCCAGTGGG - Intronic
1150287771 17:63963627-63963649 GGCTCCACCCCTACCTAAGTGGG + Intronic
1151559964 17:74864750-74864772 TGCCCCACCCCAACCCCTTAAGG + Intronic
1151670356 17:75568801-75568823 GACCCCAGCCCCACCCCAGAGGG + Exonic
1151744178 17:76002658-76002680 GGACCCCACCCAACCCCAGTAGG - Intronic
1151962807 17:77416201-77416223 GGCCTCACCCTAATCCCAGCTGG + Intronic
1151986694 17:77548428-77548450 TGCCCCACCCCCTCCCCAGGTGG + Intergenic
1152057909 17:78045961-78045983 GTCCCCATCCCACCCCCAGAGGG + Intronic
1152069956 17:78129507-78129529 CCCCCCACCCCAAGCCCATTTGG + Intronic
1152500607 17:80706261-80706283 TTCCCCTCCCCAACCCCAGAAGG + Intronic
1152663295 17:81552780-81552802 TGCCCCACCCCGACCCCGGCTGG - Intronic
1152663430 17:81553358-81553380 GTCCCCACCCCAACCTCAAAGGG - Intronic
1152748752 17:82052869-82052891 GACGCCACCTCAACCCCAGGAGG - Intronic
1152855342 17:82662492-82662514 AGCCCAACCCCAGCCCCAGTGGG + Intronic
1153496612 18:5705772-5705794 GGCCTCTGCCCAACCCCACTTGG + Intergenic
1153927004 18:9843152-9843174 CTCCTCACCCCACCCCCAGTAGG + Intronic
1154266627 18:12884257-12884279 GCCCCCACGCCAAGCCCTGTCGG + Intronic
1154376818 18:13817558-13817580 GCAGCCACCCCAACCCCAGCCGG - Intergenic
1155512239 18:26589709-26589731 GACCCCTCCCTAGCCCCAGTGGG + Intronic
1156418808 18:36928072-36928094 CTGCCAACCCCAACCCCAGTAGG + Intronic
1156467112 18:37354611-37354633 GGCACCACCCCAACCCCAAAGGG - Intronic
1157287949 18:46390138-46390160 CTCCCCACCCCAACCCCTGTGGG + Intronic
1157565361 18:48675777-48675799 TCCCCCAGCCCCACCCCAGTGGG - Intronic
1157587944 18:48817171-48817193 GGCCCCTCCCCAGCCCCGGGAGG + Intronic
1157613861 18:48975731-48975753 GTCCCCACCCCCACCCCGGGAGG - Intergenic
1157622096 18:49022632-49022654 GGCCCCAGCCCTGGCCCAGTGGG - Intergenic
1157912021 18:51625292-51625314 CTCCCCACCCCCACCCCACTGGG - Intergenic
1158131126 18:54153696-54153718 ATCCTCACCCCCACCCCAGTTGG + Exonic
1158624471 18:59059298-59059320 GGCCCCACCTCAGCCAAAGTTGG - Intergenic
1159004824 18:63002538-63002560 GTCCCCACCCAAATCCCATTTGG + Intergenic
1160089464 18:75812750-75812772 GCCCCCACCCCAAGCCCCCTTGG + Intergenic
1160811450 19:1014696-1014718 CGCCCCACTCCAACCCCGGAGGG + Intronic
1160968966 19:1759077-1759099 CCCCCCACCCCCACCCCAGGTGG + Intronic
1160992234 19:1864502-1864524 CGGCCCTCCCCACCCCCAGTGGG - Intergenic
1161068301 19:2248743-2248765 GGCCCCAGGCCCTCCCCAGTCGG - Intergenic
1161593056 19:5137382-5137404 GGCCCCGGCCCCACTCCAGTGGG + Intronic
1161653248 19:5497989-5498011 GCCCCCACCCCAACCCTGGCAGG - Intergenic
1162022505 19:7874218-7874240 GGCCCGACCCCTCCCCCAGCCGG + Intronic
1162562322 19:11423825-11423847 CGCCCCCCCCCCACCCCAGACGG - Intronic
1162567789 19:11453785-11453807 CCCCCCACCCCCGCCCCAGTTGG + Exonic
1163012761 19:14435345-14435367 GGCCCCACCCCATCCCCAGCAGG - Intronic
1163162293 19:15471856-15471878 GGCCCCGCCCCCTCCCCGGTCGG + Intronic
1163279494 19:16306917-16306939 GGCCCCACCCCCAGCCCACTGGG - Intergenic
1163605877 19:18274982-18275004 GGCCCCAGCCCAGCCCCAGGAGG - Intergenic
1163672845 19:18638494-18638516 TGCCCCACACCTACCCCAGGAGG - Intronic
1163729710 19:18941703-18941725 GCCCCCTCCCCAACCTCACTGGG - Intergenic
1164037326 19:21466426-21466448 AGCCCCACTCCACCACCAGTGGG - Intronic
1164694319 19:30232137-30232159 GCCCCCACGCCCACCCCAGGTGG - Intronic
1166326417 19:42053774-42053796 GCCCCCACCCTCACCCCAGCAGG + Intronic
1166343205 19:42150800-42150822 GCCCCCACCCCACCCCCACCCGG - Intronic
1166663968 19:44665987-44666009 GGCCTCTCCCCAGCCCCAGAGGG - Intronic
1167114336 19:47480142-47480164 GGCCCCACCCTAGCCCCACCCGG + Intronic
1167242264 19:48351411-48351433 GCCCCGTCCCCATCCCCAGTGGG + Intronic
1167418323 19:49388913-49388935 GGTCCCCTCCCAAACCCAGTCGG + Intronic
1167605371 19:50479057-50479079 GGCCCCACCTCACCCGGAGTCGG - Exonic
925076149 2:1017960-1017982 TGCCCCACGCCATCTCCAGTTGG + Intronic
925170808 2:1749291-1749313 GGCCCCAAGCCCACCCCATTAGG - Intergenic
925746522 2:7048484-7048506 GGCCCAACCCCACAGCCAGTAGG + Intronic
925905946 2:8539759-8539781 GTCTCATCCCCAACCCCAGTGGG + Intergenic
926083080 2:10004478-10004500 GGGCCCACACCAACCCCTGTGGG + Intergenic
926871031 2:17417347-17417369 GGCCCAACCCCATCCACTGTGGG + Intergenic
927138657 2:20115033-20115055 GGCCCATCCCCACTCCCAGTTGG - Intergenic
927520641 2:23696140-23696162 GGTCCCGCCCCAACCCCGGGGGG - Intronic
927645660 2:24875349-24875371 TCCCCCACCCCACCCCCCGTGGG + Intronic
927787298 2:25982569-25982591 GCCCCCTGCCCCACCCCAGTCGG - Intronic
927825123 2:26303182-26303204 GGCCTCAACCCACCCCGAGTAGG - Intergenic
927963479 2:27255142-27255164 GCCCCAGCCCCAGCCCCAGTGGG - Exonic
927971048 2:27306579-27306601 GGCCCCACCCCAAGCCCCTCAGG - Intronic
929573892 2:43040271-43040293 GGCCCCACCACGCCACCAGTGGG + Intergenic
930534556 2:52630143-52630165 GTCCCCGCCCCACCCCCAGCTGG + Intergenic
930700752 2:54456497-54456519 GCCCCCACCCCATCCCCGGGAGG + Exonic
931047799 2:58376064-58376086 GAGCCCACCCCTACTCCAGTAGG + Intergenic
931720450 2:65063605-65063627 GCCCCCACCCCTACCCCAGAGGG + Intronic
931869230 2:66441117-66441139 GGCCCCACCCCACCCCAAAAGGG - Intronic
932611314 2:73202489-73202511 GGCCCCGCCCGGACCGCAGTGGG + Exonic
932752508 2:74380193-74380215 GCCCCCACCCCTACCCGTGTAGG - Exonic
933726515 2:85430444-85430466 CTCCCCACCCCAACCTCAGTAGG - Intronic
934555721 2:95286182-95286204 GGCCCCACAACAACCCCACAGGG + Intronic
934943728 2:98521036-98521058 CTCCCCACCCCCACCCCAATGGG + Intronic
937019938 2:118640922-118640944 GACTCCATCCCAGCCCCAGTGGG + Intergenic
937309997 2:120896269-120896291 AGCCCCACCCCAGGCCTAGTGGG + Intronic
937982245 2:127622606-127622628 GGCCCCAGCCTAACCCCGGCAGG + Intronic
938368097 2:130751280-130751302 GGCCCCTCCCCCACCCTTGTTGG + Intergenic
940854956 2:158722707-158722729 ACCCCCACCCCAGCCCCAGAAGG + Intergenic
941619389 2:167759009-167759031 GGCCAGCCCCCAACACCAGTTGG - Intergenic
941716915 2:168773860-168773882 GGCCCCTCCCCACCCCTAGGGGG + Exonic
941871151 2:170387235-170387257 GCCCCCATCACAACTCCAGTTGG - Exonic
942062563 2:172241195-172241217 GGCCCAACTCCAAACCAAGTGGG + Intergenic
943718709 2:191180334-191180356 GGCAGCACCCCAACCCCACAAGG + Intergenic
944531274 2:200670119-200670141 GCCTCCACCCCAACCCCAAACGG + Intronic
946190274 2:218004082-218004104 GGCCCCCACCCACCCTCAGTTGG - Intergenic
948654946 2:239470802-239470824 GACCCCACCCCAACCCTAATTGG - Intergenic
948894151 2:240920548-240920570 GCACCGACCCCAACCCCAGATGG + Intronic
948916639 2:241037681-241037703 GGCCCCACCACATCCCCAGCGGG - Intronic
949023170 2:241752760-241752782 GCCCCCACACCACCCCCAGGAGG + Intronic
1169897304 20:10518001-10518023 TGCCCCTCCCCACTCCCAGTAGG - Intronic
1170656641 20:18292919-18292941 CTCCCCACCCCTACACCAGTTGG - Intronic
1171300248 20:24053321-24053343 AGCCCCACCCCTGCCCCAGCAGG - Intergenic
1171848057 20:30289841-30289863 CGCCCCAACTCAACCCCAGCAGG - Intergenic
1172090756 20:32430548-32430570 CACCCCACCCCACCCCCATTAGG + Intronic
1172766579 20:37354372-37354394 GTCCCCACCCCAGCCCCACCGGG - Intronic
1174350739 20:49965859-49965881 GGGCCCAACCCCACCCCAGCAGG + Intergenic
1175899832 20:62355578-62355600 TGCCCCGCCCCAACCCCGGAAGG - Intronic
1176385676 21:6137667-6137689 TACCCCACCCCAACCACAGAAGG + Intergenic
1179156677 21:38857262-38857284 GGCCCCACAGCAAACCCAGAGGG - Intergenic
1179617863 21:42593531-42593553 GGCCCCACCCCCGCCCCAGCTGG + Intergenic
1179657693 21:42855368-42855390 GGCCCCACCCCTGCCCCACCTGG + Intronic
1179737797 21:43400585-43400607 TACCCCACCCCAACCACAGAAGG - Intergenic
1179838032 21:44050390-44050412 CTCCCCACCCCCACCCCAGAAGG - Intronic
1179949875 21:44703548-44703570 GGCCCCACCCCAGCCCACCTAGG - Intronic
1181688073 22:24542953-24542975 GACCCCATCCCCACCCCAGCCGG - Exonic
1181698019 22:24603553-24603575 GCCCCCAGCCCAGACCCAGTCGG - Intronic
1182797365 22:33000652-33000674 GAACCCACCCCAACCCCAACGGG - Intronic
1183406519 22:37633043-37633065 GGCCCAGCCCCAACCCCAGCTGG + Exonic
1183472802 22:38018573-38018595 GACCCCAGCCCAGCCCCAGATGG - Intronic
1183585585 22:38751196-38751218 GGCTCCACACTCACCCCAGTTGG + Exonic
1184488508 22:44795848-44795870 AGCCCCTCCCCCACCCCAGGTGG + Intronic
1184688718 22:46107935-46107957 GGCTCCACCCCCACCGCAGGAGG - Intronic
1185365776 22:50436094-50436116 GCCCCTACCGAAACCCCAGTGGG - Intronic
1185417504 22:50718338-50718360 GGTCCCACCCCCGCCCCAGATGG + Intergenic
950295354 3:11824956-11824978 CTCCCCACACCCACCCCAGTGGG - Intronic
950577026 3:13838109-13838131 GGCCCCACCGCACCCTCAGCTGG - Intronic
953334706 3:42084564-42084586 TGCCACAACCCACCCCCAGTGGG - Intronic
954330071 3:49885083-49885105 GGGCCCATCCCCACCTCAGTTGG - Intergenic
954377939 3:50204826-50204848 GCCCCCACCCCACCCCTGGTTGG + Intergenic
954603870 3:51894050-51894072 GGCCCCAACCCCACCCCAGCTGG + Intergenic
954615909 3:51968430-51968452 GGCCCCTCCCCCACCCCGGCGGG - Intronic
954677124 3:52322207-52322229 GGCCCCACCCCATCTCCTGGTGG + Intronic
956130306 3:66047028-66047050 CCCCCCACCCCAACCCCCGGAGG + Intergenic
959055971 3:101568012-101568034 TGCCCCACCCCACCCCAAATTGG + Intergenic
959571044 3:107884363-107884385 GTCCCTACCCCAACCTGAGTTGG - Intergenic
960576728 3:119237499-119237521 GGCCCCACTCCAAAGCCAATGGG + Intronic
961440742 3:126951706-126951728 GTCCCCAGCCCATCCCCAGCTGG - Intronic
961462593 3:127061966-127061988 GATGCCACCCCAACCCCAGCGGG - Intergenic
961504387 3:127360592-127360614 TGCCCCAGCCCAAGCCCAGATGG - Intergenic
963891571 3:150641285-150641307 GCCCCCACCCCAACCCCGAGTGG - Intergenic
965144119 3:164876798-164876820 GGCCTCACCCCACACCCAGAAGG + Intergenic
965515703 3:169619215-169619237 GGCCGCAGCGCATCCCCAGTCGG + Intronic
965585792 3:170317084-170317106 GGAAACACCCCAACCCCACTGGG - Intergenic
965700783 3:171458177-171458199 CGCAGCACCCCACCCCCAGTCGG + Intronic
965742140 3:171886643-171886665 GACCCCACCCCAACCACCTTAGG + Intronic
965881884 3:173396850-173396872 CCCCCCACCCCCACCCCAATGGG - Intronic
966906135 3:184527107-184527129 GGCCCTGCCCCATCCCCAGAAGG - Intronic
968235119 3:197026842-197026864 GGCCCCACCCCAAGCCCCAGAGG + Intronic
968621245 4:1604342-1604364 GCCCCCACCCCAACCTGCGTAGG - Intergenic
968640561 4:1712449-1712471 GGCCTCGCCCTAGCCCCAGTCGG - Exonic
968760780 4:2442023-2442045 AGCCCCACCCCAACTCCAGCAGG + Intronic
968921352 4:3523844-3523866 ACCCCCACCCCCACCACAGTGGG + Intronic
969639727 4:8389552-8389574 GAACCCACCCCTGCCCCAGTTGG + Intronic
969658118 4:8509667-8509689 GGCCCCACACCACACCCAGGAGG + Intergenic
969672071 4:8595360-8595382 TTCCCCACCCCAACCACCGTGGG - Intronic
969686417 4:8676992-8677014 GGCCCCACCCCACACCCACAAGG + Intergenic
984999830 4:185471783-185471805 GGCCCCACCCCCACCCTCGGCGG + Intronic
985431802 4:189888260-189888282 GCCCCCACACCATCCCCACTGGG - Intergenic
986195418 5:5533341-5533363 TCCCCCATCCCGACCCCAGTAGG + Intergenic
988666381 5:33332751-33332773 TGCCCAACCCCAACCCCACTGGG + Intergenic
988966158 5:36420117-36420139 GGCCCCAGCCCACCCACAGATGG + Intergenic
989214556 5:38891515-38891537 GGCTCCACACCAGTCCCAGTAGG - Intronic
990248187 5:53884400-53884422 GGCCCCACCCCGCCCCCACGTGG + Intronic
990727918 5:58776751-58776773 GGAACCTCCCCAACCCCTGTGGG - Intronic
992048899 5:72925764-72925786 GGAGCCTCCCCACCCCCAGTGGG + Intergenic
995477176 5:112560093-112560115 GGCTCCACCCCCACCCCACCAGG - Intergenic
997209300 5:132068142-132068164 CTCCCCACCCCAGCCCCAGGAGG - Intergenic
997828333 5:137127521-137127543 GGCAGTACCCCTACCCCAGTGGG + Intronic
998169431 5:139863881-139863903 CTCCCCACCCCAACCCCACAGGG - Intronic
999139722 5:149351157-149351179 GGCTGCACCCCAACACCAGCTGG - Exonic
1001804410 5:174571017-174571039 GGCCCTACCCCAGTTCCAGTGGG + Intergenic
1002298346 5:178243706-178243728 GGCTCCTCCTCAACCCCAGAAGG - Intronic
1002329775 5:178433402-178433424 GACCCCACCCCAACTCCACAGGG - Intronic
1002333771 5:178463997-178464019 GCCGCCTCCCCAACACCAGTTGG + Intronic
1002575569 5:180171975-180171997 GACCCCACCCCTAACCCAGTAGG - Intronic
1002639360 5:180623437-180623459 ACCCCCACCCCACCCCCAGCTGG + Intronic
1003438865 6:6121602-6121624 GGCCCCACCCCCTACCAAGTTGG + Intergenic
1004813522 6:19287143-19287165 GTCCCCAGCCCAACACCATTAGG - Intergenic
1004870247 6:19896965-19896987 GGCCCCAACGAAACCCCACTTGG - Intergenic
1005013840 6:21359560-21359582 GGCCCCACCCAAACCCCTCAGGG + Intergenic
1005282826 6:24292850-24292872 GTAGCCACCCCATCCCCAGTTGG + Intronic
1006083398 6:31580363-31580385 GGCCCCACCATTAGCCCAGTTGG - Intergenic
1006862667 6:37183307-37183329 TGCCCCACCCCAACCCCCCCGGG - Intergenic
1006915933 6:37593984-37594006 TGCCCCATCCCACCCCCAGAAGG - Intergenic
1007581574 6:42963221-42963243 ACCCCCACCCCCACCCCAGAGGG - Intronic
1010029254 6:71256152-71256174 AGCCCCACCCCTATCCCTGTTGG - Intergenic
1011089707 6:83583282-83583304 GCCCCGACTCCAACCCCAGATGG + Intronic
1011161590 6:84396855-84396877 AGCCCCACACCACCCCCAGCAGG - Intergenic
1014779329 6:125545039-125545061 TGCCCTACCCCAACCGCAGCAGG - Intergenic
1018907942 6:168086089-168086111 GGAGCCACCCCATCCCCAGCAGG + Intergenic
1019407016 7:889203-889225 GGGCCCGCACCTACCCCAGTGGG - Intronic
1019418202 7:936943-936965 GGCCCAGCCCCAGCCCCACTGGG - Intronic
1019485656 7:1288136-1288158 GGCAGCACCCCTACCCCAGCGGG + Intergenic
1019514813 7:1434985-1435007 GCCCCCCCCCCACCCCCAGCTGG + Intronic
1020111800 7:5451843-5451865 GGCCCCAGTCCCACCCCAGGAGG + Intronic
1023836883 7:44073740-44073762 GGCCCAGCCCCACCCCCAGGCGG + Intronic
1023995669 7:45157747-45157769 CGCCCCACCCCAACCCCAACCGG + Intergenic
1024280534 7:47715595-47715617 ACCCCCACCCCAACCCAAGTAGG + Intronic
1024766750 7:52669063-52669085 TACCCCACCCCAACCACAGAGGG + Intergenic
1025263787 7:57439633-57439655 TGCCCCACCCCCACCCCACAGGG - Intergenic
1029444058 7:100603166-100603188 GTCCCCACCCCCACCCCAACAGG - Intronic
1029608807 7:101615644-101615666 GCCCCCACACCCACCCCACTAGG + Intronic
1030106346 7:105990555-105990577 GGCCCCAAACCCACCCCAGAGGG - Intronic
1030177071 7:106665391-106665413 GTGCCCACCCCACCCCCATTAGG + Intergenic
1030715507 7:112803097-112803119 GGCCCCACCCAAACCCCTCAGGG + Intergenic
1031693018 7:124814151-124814173 GGCACCAGCCCAGCCCAAGTTGG - Intergenic
1031983765 7:128148797-128148819 GCCCCCACCCCTACCCCAGTGGG - Intergenic
1032677375 7:134143856-134143878 GGCCCCACCCCAGACCTAATGGG - Intronic
1034247304 7:149656690-149656712 GGCGCCCCCCCAACCACGGTTGG - Intergenic
1034437755 7:151071255-151071277 GGCTCCAGCCCAGCCCCTGTAGG - Exonic
1034489650 7:151386479-151386501 GGGCCCACCGTAACCCCAGCAGG - Intronic
1036141475 8:6212966-6212988 GTCCCCACCCCTGCCCCAGCAGG - Intergenic
1037587565 8:20288515-20288537 TGCCTCACCCCAACCCCAAGAGG + Intronic
1037787897 8:21913152-21913174 GGTTCCTTCCCAACCCCAGTGGG - Intronic
1037917130 8:22779404-22779426 GGTCCCACACCAAGGCCAGTGGG + Intronic
1038351114 8:26777142-26777164 GGCCCCACATAAACCCCAGGAGG - Intronic
1038804660 8:30779067-30779089 GCCCTCACCCCTTCCCCAGTTGG - Intronic
1039549541 8:38432907-38432929 CGCCCCCCCCCCTCCCCAGTTGG + Intronic
1039943613 8:42111658-42111680 GGCCACCACCCAGCCCCAGTGGG + Intergenic
1041053284 8:53957699-53957721 GGCCCCACCCCAGACTCAGTAGG - Intronic
1041312303 8:56529542-56529564 CCCCCCGCCCCCACCCCAGTAGG + Intergenic
1041550101 8:59090931-59090953 AGTCCCACCCCAGCCTCAGTAGG + Intronic
1043099348 8:76020861-76020883 TTCCCCACCCCAACCCCATTGGG + Intergenic
1043910022 8:85853475-85853497 GGCCCCATCCCAGACCTAGTGGG - Intergenic
1044566768 8:93670738-93670760 GGCCCACCTCCAACCTCAGTGGG - Intergenic
1045625931 8:104050398-104050420 TTCCCCACCCCAATCCCACTAGG - Intronic
1047967181 8:130054851-130054873 GGCCCCACGACAAACCCAGTGGG + Intronic
1048296857 8:133220854-133220876 GGTCCCACCCCCAGCCCACTCGG - Intronic
1048460827 8:134620360-134620382 GGCCCCACTCCAGCCCGAGAAGG + Intronic
1048487255 8:134859828-134859850 AGCCCCAACACAACCCCTGTGGG + Intergenic
1049283461 8:141762247-141762269 GGCCCCAGCCCAGCCTCAGAAGG - Intergenic
1049498088 8:142946066-142946088 TGCCCCACCCCAGCCACAGCTGG - Intergenic
1049537651 8:143189647-143189669 ACCCCCACCCCCACCCCCGTGGG + Intergenic
1049537697 8:143189734-143189756 ACCCCCACCCCCACCCCCGTGGG + Intergenic
1049542652 8:143215524-143215546 GGCCCCTCCCCACCCCCACCCGG + Intergenic
1049773753 8:144395408-144395430 GCCCCCACCCCCACCCCACCAGG - Intronic
1053786192 9:41654490-41654512 CGCCCCAACTCAACCCCAGCAGG - Intergenic
1054449766 9:65397483-65397505 CGCCCCAACTCAACCCCAGCAGG - Intergenic
1057030371 9:91770379-91770401 GGGCCCACCCCAGCCTCACTCGG + Intronic
1057941875 9:99292139-99292161 GGCCCCACAACAATCGCAGTGGG - Intergenic
1060062001 9:120469031-120469053 GGCCTTACCACAGCCCCAGTAGG + Intronic
1060476192 9:123988524-123988546 AGCTCCACCCCAATCCCAGTAGG - Intergenic
1061090105 9:128421386-128421408 GGGCCCAGCTCAACCCCAGTGGG + Intronic
1061385858 9:130289053-130289075 GGCCCCACCCCCACCACTGTCGG - Intronic
1061615128 9:131774365-131774387 GGCCACTCACCAACCCCAGCTGG - Intergenic
1062102908 9:134737796-134737818 GGCCTCACTCTAACCCCAATGGG - Intronic
1062125813 9:134861785-134861807 GGCCCCACCTGAACCACAGCTGG - Intergenic
1062472990 9:136714386-136714408 GGCCCTGGCCCAAGCCCAGTCGG + Intronic
1062628747 9:137454283-137454305 ACCCCCGCCCCAACCCCAATCGG - Intronic
1185451726 X:284311-284333 TGCCCCACCCCAACCTCACCTGG - Exonic
1185703429 X:2248727-2248749 GGTCCCACCCCACCCCCAGAAGG + Intronic
1186314063 X:8349846-8349868 GGTCCCACCCCATACCCAGAAGG - Intergenic
1186399536 X:9244547-9244569 CCCCCCACCCCCACCCCAGCTGG + Intergenic
1186509022 X:10116914-10116936 GTTCTCACCCCAGCCCCAGTGGG + Intronic
1186578135 X:10788595-10788617 TACCCCACCCCCACCCCAGTTGG - Intronic
1189465848 X:41276960-41276982 GCCCCCATCCCCACCCCAGCAGG - Intergenic
1189911303 X:45813041-45813063 CTCCCCTCCCCACCCCCAGTAGG + Intergenic
1190214523 X:48470650-48470672 GCCCTCACCCCACCCACAGTTGG + Intergenic
1192588564 X:72340485-72340507 TGCCCCACCCAAACACCAGTGGG + Intronic
1192763555 X:74120897-74120919 CCCCCCACCCCCACCCCACTGGG - Intergenic
1193117073 X:77785789-77785811 ATCCCCACCCCCACCCCCGTCGG + Intronic
1195355940 X:104040113-104040135 GGCGCCACGCCAACCGCCGTGGG + Exonic
1197746770 X:129936798-129936820 AGCCCCACACCAACCCCAAGAGG + Intergenic
1198171395 X:134108802-134108824 GGCCCCTTTCCATCCCCAGTGGG - Intergenic
1199838881 X:151623418-151623440 AGCTCCACCACAACCCCATTGGG + Intronic
1200038280 X:153347149-153347171 AGCCCCAGCCCGGCCCCAGTAGG + Exonic
1200116133 X:153770464-153770486 GTCGCCACCCCTACCCCAGGAGG - Intronic
1200231328 X:154445179-154445201 GGCCCCAGCCCCAACCCACTTGG - Intronic
1200267238 X:154653070-154653092 GCCCCCACCCCCACCCCACCCGG + Intronic