ID: 1076008312

View in Genome Browser
Species Human (GRCh38)
Location 10:126965918-126965940
Sequence GGTTAACTATAGTCATCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076008307_1076008312 11 Left 1076008307 10:126965884-126965906 CCTTCCAGCCATTTAAAACTGTA 0: 1
1: 0
2: 8
3: 114
4: 627
Right 1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG No data
1076008309_1076008312 7 Left 1076008309 10:126965888-126965910 CCAGCCATTTAAAACTGTATGGT 0: 1
1: 0
2: 0
3: 19
4: 240
Right 1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG No data
1076008310_1076008312 3 Left 1076008310 10:126965892-126965914 CCATTTAAAACTGTATGGTATAT 0: 1
1: 0
2: 1
3: 48
4: 394
Right 1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076008312 Original CRISPR GGTTAACTATAGTCATCCTA AGG Intronic
No off target data available for this crispr