ID: 1076013327

View in Genome Browser
Species Human (GRCh38)
Location 10:127007538-127007560
Sequence AAGAATAACCCCAGATGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076013327_1076013330 5 Left 1076013327 10:127007538-127007560 CCGGGCCATCTGGGGTTATTCTT No data
Right 1076013330 10:127007566-127007588 TTCTTGTTCTGTCATGACCAAGG No data
1076013327_1076013332 13 Left 1076013327 10:127007538-127007560 CCGGGCCATCTGGGGTTATTCTT No data
Right 1076013332 10:127007574-127007596 CTGTCATGACCAAGGGCAAAAGG No data
1076013327_1076013334 27 Left 1076013327 10:127007538-127007560 CCGGGCCATCTGGGGTTATTCTT No data
Right 1076013334 10:127007588-127007610 GGCAAAAGGAATTGTTTGAAAGG No data
1076013327_1076013331 6 Left 1076013327 10:127007538-127007560 CCGGGCCATCTGGGGTTATTCTT No data
Right 1076013331 10:127007567-127007589 TCTTGTTCTGTCATGACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076013327 Original CRISPR AAGAATAACCCCAGATGGCC CGG (reversed) Intronic
No off target data available for this crispr