ID: 1076015449

View in Genome Browser
Species Human (GRCh38)
Location 10:127024058-127024080
Sequence TGACCTCTGGTCATCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076015449_1076015452 2 Left 1076015449 10:127024058-127024080 CCTCCTCTGATGACCAGAGGTCA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1076015452 10:127024083-127024105 TCAGAGCTGCTGTCCCTGTGAGG No data
1076015449_1076015455 24 Left 1076015449 10:127024058-127024080 CCTCCTCTGATGACCAGAGGTCA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1076015455 10:127024105-127024127 GTGCCTCTTTGCACCAGTGCTGG No data
1076015449_1076015457 27 Left 1076015449 10:127024058-127024080 CCTCCTCTGATGACCAGAGGTCA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1076015457 10:127024108-127024130 CCTCTTTGCACCAGTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076015449 Original CRISPR TGACCTCTGGTCATCAGAGG AGG (reversed) Intronic
901396982 1:8988736-8988758 GGACCTCTGGGCTTCCGAGGGGG + Intergenic
902078734 1:13806639-13806661 GGACCTCAGGTCAGCTGAGGAGG - Intronic
902295146 1:15462168-15462190 TGACCTCTGCTCATCACAGCTGG + Intronic
902298008 1:15481705-15481727 TGACCTCTGCTCATCACAGCTGG + Intronic
904916181 1:33972131-33972153 GGACTTCTGGACAGCAGAGGGGG + Intronic
905307549 1:37029973-37029995 TGACCTAGGGTCTTTAGAGGTGG - Intronic
905654219 1:39675656-39675678 TGAGCTCTGAGCTTCAGAGGAGG - Intergenic
907789528 1:57648336-57648358 TGAACTCTATTCATTAGAGGAGG + Intronic
908339713 1:63164183-63164205 TGACCTCAGGTGATCAGTGCTGG + Intergenic
911251275 1:95579293-95579315 TGAACTCTGGTGATAAAAGGAGG + Intergenic
915211519 1:154313093-154313115 TGGGGTCTGGTCATCAGAGCAGG + Intergenic
916051031 1:161037282-161037304 TGACCTCTGGTCTACAGCAGTGG + Intronic
917580099 1:176368238-176368260 TGGGCTCTGGTCTTCCGAGGTGG + Intergenic
918950013 1:191125141-191125163 TGAGCTCTGCTCATTAGAGCAGG - Intergenic
922764978 1:228151939-228151961 TGAGCTCTGGGCATCAGGGTAGG + Intronic
923567974 1:235091018-235091040 TGACGTCTGGTCTTCAGTGTGGG - Intergenic
923679941 1:236111149-236111171 TGGCCTCTGGACATCCGAGTAGG + Intergenic
924770991 1:247079103-247079125 TGGCCTCTGGTCTTTTGAGGAGG + Intergenic
1065184362 10:23157695-23157717 TGTCCTCTGGTCAACCGGGGAGG + Intergenic
1065888262 10:30097994-30098016 AGACTTCTGGCCATCAAAGGTGG + Intronic
1070654753 10:78263693-78263715 TGCCACTTGGTCATCAGAGGTGG - Intergenic
1070719726 10:78747724-78747746 TGCCCCCTGGTCCTCACAGGAGG + Intergenic
1070758293 10:79006889-79006911 TGACCCCAGGTCAGCAGGGGAGG - Intergenic
1073096956 10:100985648-100985670 TGTCCCCTGGTGATCAGGGGTGG - Intronic
1073564366 10:104522522-104522544 CTCCCTCTGGTCCTCAGAGGAGG + Intergenic
1073631608 10:105155284-105155306 TGAGCTGGGGGCATCAGAGGGGG + Intronic
1074982398 10:118630307-118630329 TGAACCCTGGCCACCAGAGGTGG - Intergenic
1075917819 10:126184782-126184804 TGAACTCTGGTCCTCTCAGGTGG - Intronic
1076015449 10:127024058-127024080 TGACCTCTGGTCATCAGAGGAGG - Intronic
1076686058 10:132198986-132199008 TGGCCCCTCGGCATCAGAGGCGG - Intronic
1081284437 11:41249932-41249954 TGACCTCAGGTGATCAGATCAGG - Intronic
1085077490 11:73604611-73604633 TGAGCTCTGGGCCACAGAGGTGG - Intergenic
1085779711 11:79397057-79397079 AGACCTCTGGGCCTCAGAAGAGG + Intronic
1086352492 11:85956418-85956440 CGATGTCTGGGCATCAGAGGAGG + Intergenic
1089284235 11:117395396-117395418 AGACCTCTTGACCTCAGAGGTGG + Intronic
1089419768 11:118322758-118322780 CGAACTCTGGGCCTCAGAGGAGG - Intergenic
1089831857 11:121335920-121335942 TCTCCACTGGCCATCAGAGGTGG - Intergenic
1089965907 11:122655152-122655174 GGACCTCAGGTTCTCAGAGGTGG - Intergenic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1090239178 11:125170068-125170090 TGACATCTGGTCGGCTGAGGGGG + Intronic
1092153691 12:6268549-6268571 TGACCCCTGGTCAGCTGTGGTGG + Intergenic
1092491621 12:8950330-8950352 TAACCTCTGGCGAACAGAGGTGG - Intronic
1093236934 12:16620959-16620981 TAATCTCTGGTCATCAGAGATGG + Intergenic
1095691243 12:45091689-45091711 TAACCTCAGGTCATGAGCGGTGG - Intergenic
1095999973 12:48121137-48121159 TGACCTGTGGTAATCAGTGAAGG + Intronic
1096370324 12:51063952-51063974 TGCCCTCTGTAAATCAGAGGTGG - Exonic
1096755110 12:53792915-53792937 AGACTTCTGATCATCAGAGATGG + Intergenic
1098987919 12:77032070-77032092 TGAGCTGTGCTCACCAGAGGTGG - Intronic
1102994652 12:117339297-117339319 TGAGATATGGGCATCAGAGGTGG - Intronic
1103174253 12:118848240-118848262 TGACCACTGGTTTTCAGAGGGGG + Intergenic
1104045429 12:125159448-125159470 TGACCTTTGTACATCAAAGGAGG - Intergenic
1106152041 13:27113804-27113826 TAACCTATGGCCATCAGATGAGG + Intronic
1107239538 13:38215296-38215318 TGACATCTGGACATCAGAGTGGG + Intergenic
1116229211 14:42194335-42194357 TGACCTGTGGTCAACAGATTAGG - Intergenic
1119039947 14:71264370-71264392 TGACCTCTGCTCATCAAACAGGG + Intergenic
1121245421 14:92458331-92458353 GGCCTTCTGGTCAGCAGAGGAGG - Intronic
1122523120 14:102360775-102360797 TGCCCTCTGTGCATCAGAGCTGG + Intronic
1123700979 15:22914663-22914685 TGACCGGGGGTCCTCAGAGGAGG - Intronic
1124412403 15:29447317-29447339 TGCCCACTGATCAGCAGAGGTGG - Intronic
1125685581 15:41561391-41561413 AGACCTCTGGGCATCAGGAGAGG - Intronic
1128388599 15:67167593-67167615 TCTCCACTGGTCATCAGAAGAGG - Intronic
1130153794 15:81332630-81332652 TTCCCTCTGGGCTTCAGAGGGGG + Exonic
1135427412 16:22350488-22350510 TGAGGTCTGGTCACCAGAGAAGG - Intronic
1137253959 16:46760114-46760136 TGATCTCTGCTCATCCAAGGGGG + Intronic
1137272586 16:46912087-46912109 AGACATATGGTCATCACAGGTGG - Intronic
1137678267 16:50315322-50315344 AGACCTGTTGTCTTCAGAGGCGG - Intronic
1139852532 16:69959722-69959744 GGACCTCTGGTCAGAGGAGGAGG - Exonic
1139881503 16:70182630-70182652 GGACCTCTGGTCAGAGGAGGAGG - Exonic
1139946666 16:70646847-70646869 TGGCCTCGGGGCAGCAGAGGTGG - Exonic
1140371006 16:74412875-74412897 GGACCTCTGGTCAGAGGAGGAGG + Exonic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1142684323 17:1569003-1569025 TGACTTCAGGTGATCCGAGGGGG + Intergenic
1143706156 17:8698945-8698967 AGACAGCTGGTCAGCAGAGGTGG + Intergenic
1144025284 17:11271780-11271802 TGAGCTTTGGCCAGCAGAGGGGG - Intronic
1147127020 17:38378074-38378096 TGATGCCTGGACATCAGAGGTGG - Intronic
1148078743 17:44955715-44955737 GGAGCTCTGAGCATCAGAGGAGG - Intergenic
1151218429 17:72593168-72593190 GGACCTCTGGTCTCCAGAAGTGG - Intergenic
1152804040 17:82346544-82346566 TTACCTATTGTCAGCAGAGGAGG + Intergenic
1153673201 18:7432264-7432286 TGCTCTCGGGTCATCAGAGCTGG - Intergenic
1153747891 18:8198994-8199016 TGTCCTCTGCGCATCTGAGGAGG - Intronic
1155228346 18:23749951-23749973 CTACATCTGGTCATCAGATGAGG - Intronic
1157186811 18:45547905-45547927 TGGCCTGGGGTGATCAGAGGAGG + Intronic
1157673462 18:49550169-49550191 TGAACTCAGGTCATCAGCTGAGG + Intergenic
1159968490 18:74620739-74620761 GGGCCTCTGGTCATCGGATGTGG - Intronic
1163288482 19:16364017-16364039 TGACCTCTGGCCACCAGCTGCGG + Intronic
1165298281 19:34946689-34946711 AAACTTCTGGCCATCAGAGGTGG + Intergenic
1166384402 19:42372270-42372292 TAGCCTCAGTTCATCAGAGGGGG - Intronic
1166483673 19:43194871-43194893 TTACTTCTGGACATCCGAGGTGG - Intronic
927488328 2:23504463-23504485 TCACCTCTGGGCAGCAAAGGCGG + Intronic
928235437 2:29535330-29535352 TTACCTCTGGTCACCAGTGTAGG + Intronic
929352265 2:40971548-40971570 TGTCCTTTGGAGATCAGAGGTGG + Intergenic
929793735 2:45042251-45042273 AAACCTCAGGTCTTCAGAGGAGG + Intergenic
932916773 2:75868090-75868112 TGAGCTCTGGAGATCAGGGGGGG + Intergenic
934758127 2:96838896-96838918 TGGGTTCTGGTCATCTGAGGTGG - Exonic
935211599 2:100943665-100943687 TGACCCCTGGTCCCCACAGGAGG + Intronic
940991747 2:160104259-160104281 TGACCTCTGATCTTCAGCTGAGG - Intronic
943104855 2:183531706-183531728 TGAACACTGGTCATCAGTCGGGG + Intergenic
945609330 2:211978741-211978763 TATCCTCAGGTCACCAGAGGAGG - Intronic
946816897 2:223588058-223588080 TGACTTCTGGACATCATAGAGGG - Intergenic
947233925 2:227920414-227920436 TGTCTTCTGGTGATTAGAGGGGG + Intronic
948489418 2:238302939-238302961 GCGCCTCTGGGCATCAGAGGAGG - Intergenic
1168737792 20:158375-158397 TGTTCTCTGGGCATCAGAGGAGG + Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1173861775 20:46288413-46288435 TTACATGTGGTCATCTGAGGAGG - Intronic
1174403964 20:50291971-50291993 TCACCCCTGTTCATCAGATGAGG - Intergenic
1179909672 21:44441206-44441228 TGAGCTCTGGCCACCTGAGGTGG - Intronic
1181405542 22:22681897-22681919 TGACCTGTGGCCATTACAGGGGG - Intergenic
1181983969 22:26786431-26786453 GGACCTCTGGTCCCCAAAGGTGG + Intergenic
1182572370 22:31248806-31248828 TGGCCCCTGGTCCTGAGAGGAGG + Intronic
1182642497 22:31779687-31779709 TGACCTTTGGCCATTAGAGCCGG - Intronic
1182972343 22:34590145-34590167 TGGCCTCTGGACATCTGAGTGGG - Intergenic
1183922099 22:41177616-41177638 GGACCTCTGGTCATGGGAGGTGG - Exonic
1183977345 22:41520255-41520277 TGGCCTCTGGACATCCGAGTGGG + Exonic
1184367015 22:44058181-44058203 GGACTTCTGGTCTTCAGAGCTGG - Intronic
1184505914 22:44902100-44902122 GGACCTCTGGTCCTCAGTTGAGG + Intronic
949651394 3:6164185-6164207 TGAGCTCTGGTCATCTGAGCTGG + Intergenic
949847147 3:8383270-8383292 TGACATCCAGTCAACAGAGGTGG - Intergenic
950431551 3:12953974-12953996 AGACCTCTGGTCCTCAGACATGG + Intronic
950763448 3:15255530-15255552 CCACCTCTGGTGTTCAGAGGGGG - Exonic
953932830 3:47014526-47014548 TGCCCTAAGGTCATCTGAGGAGG - Intergenic
959778456 3:110199570-110199592 TGTTCTCTGCTCATCACAGGCGG - Intergenic
960283436 3:115800714-115800736 TGACCTCTGGGCAGGGGAGGGGG + Intergenic
960335167 3:116409019-116409041 TGATCTCTGGTGCTCAGATGGGG - Intronic
961626399 3:128266742-128266764 GGACCAATGGTCTTCAGAGGAGG - Intronic
962339020 3:134565703-134565725 TTACCTCTGAGCTTCAGAGGGGG + Intronic
962347270 3:134627290-134627312 TGACATCTGGTCTACTGAGGGGG + Intronic
969260840 4:6032392-6032414 TGAACCCAGGTCATCAGATGAGG - Intronic
969274218 4:6124268-6124290 TGACCTCTTGGCATCAGTGATGG - Intronic
969707170 4:8818378-8818400 TGAGCTCTGGTCCCCAGAGGTGG + Intergenic
971260521 4:25052739-25052761 TCACCTCAGGTCCTCATAGGAGG + Intergenic
971738294 4:30486074-30486096 TGAGATGTGGTCATAAGAGGGGG + Intergenic
972343072 4:38169520-38169542 TGACCTCTGGGCATCCATGGTGG - Intergenic
973762628 4:54133524-54133546 TGACCTCTGGACCCCAGAAGTGG + Intronic
975858091 4:78646273-78646295 TGACCAATAGTCATCACAGGGGG - Intergenic
981302752 4:143207736-143207758 TGACCTCTGGTGGTAAGATGGGG - Intronic
983528725 4:168787319-168787341 TGATCTCTTGTGCTCAGAGGAGG - Intronic
991413387 5:66367097-66367119 GGCCCTCAGGCCATCAGAGGTGG - Intergenic
996623594 5:125541184-125541206 TGACCTCTGGTTCCCACAGGAGG + Intergenic
999106018 5:149071853-149071875 TGACCTCTGGGGAAGAGAGGGGG + Intergenic
1001232792 5:170003881-170003903 TGACTTCTGGAACTCAGAGGAGG - Intronic
1005418390 6:25625187-25625209 TTCCCTCAGGTCCTCAGAGGAGG + Intergenic
1013388786 6:109661618-109661640 TGACCCCTGGCCATGAGTGGTGG + Intronic
1014284041 6:119476402-119476424 TGACATCTGGTAGTCCGAGGGGG - Intergenic
1014890888 6:126844678-126844700 TGACTGCAGGCCATCAGAGGAGG + Intergenic
1016383573 6:143510404-143510426 TGACCTCAGGTGATCCGCGGTGG - Intronic
1016635947 6:146290506-146290528 TGCCCTCTGGTCATGAGACTTGG - Intronic
1018396432 6:163381321-163381343 TGACCTCTGGTCAGCTAAGGCGG - Intergenic
1027498275 7:78915849-78915871 TTACATAAGGTCATCAGAGGAGG + Intronic
1027978233 7:85185738-85185760 TGAACTCGAGTCATCAGAGAAGG + Intronic
1029433047 7:100544590-100544612 TGACCTCTGCTGGGCAGAGGTGG + Intronic
1033174888 7:139114673-139114695 TCACCTGTGGTCATGTGAGGGGG - Intergenic
1035037906 7:155907339-155907361 TTACCTCTGTTCTACAGAGGGGG + Intergenic
1040044878 8:42952511-42952533 TGACCTCTGGGAAACAAAGGAGG - Intronic
1047479193 8:125264636-125264658 TGACCTCAGGTGATCAGGGTGGG + Intronic
1048832728 8:138492395-138492417 TGACTTCAGGTAATGAGAGGTGG - Intronic
1050054782 9:1640454-1640476 TGACCTCTAGCCATGAGAGTAGG + Intergenic
1055144717 9:72919458-72919480 TGACCTAGTGTCATCAGAGAAGG - Intronic
1055366079 9:75546402-75546424 TGAGCCCTGGACATAAGAGGGGG - Intergenic
1057140480 9:92723943-92723965 TGACCTCTGGCCACCAGACACGG + Intronic
1057248635 9:93481135-93481157 TGGCCTGTACTCATCAGAGGCGG + Intronic
1057906012 9:98984077-98984099 TGCCCTCTGGCCTCCAGAGGAGG + Intronic
1059716667 9:116919583-116919605 TGTTCTGTGGTCATCAGAGGAGG - Intronic
1187449939 X:19387312-19387334 TGAACTCTGGACACCAGATGGGG + Intronic
1192441154 X:71175021-71175043 TGAACACTGGGCATCAGATGTGG - Intergenic
1195448707 X:104984540-104984562 TGAACTGTGGTCATCAGAGCAGG + Intronic
1198868857 X:141154848-141154870 TGTCCTCTGGAAATCAGAGTTGG - Intergenic
1200457858 Y:3414729-3414751 TGAGCTCTGGTAACAAGAGGAGG - Intergenic