ID: 1076016347

View in Genome Browser
Species Human (GRCh38)
Location 10:127030375-127030397
Sequence GTGGCTGGTGACAGACAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076016347_1076016351 10 Left 1076016347 10:127030375-127030397 CCTCGCTGTCTGTCACCAGCCAC 0: 1
1: 0
2: 0
3: 16
4: 243
Right 1076016351 10:127030408-127030430 TGTCCCCAGATGTGCCACACTGG No data
1076016347_1076016355 21 Left 1076016347 10:127030375-127030397 CCTCGCTGTCTGTCACCAGCCAC 0: 1
1: 0
2: 0
3: 16
4: 243
Right 1076016355 10:127030419-127030441 GTGCCACACTGGTCCTCGTGAGG No data
1076016347_1076016356 22 Left 1076016347 10:127030375-127030397 CCTCGCTGTCTGTCACCAGCCAC 0: 1
1: 0
2: 0
3: 16
4: 243
Right 1076016356 10:127030420-127030442 TGCCACACTGGTCCTCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076016347 Original CRISPR GTGGCTGGTGACAGACAGCG AGG (reversed) Intronic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
901064194 1:6486903-6486925 TGGGCTGATGACAGACAGCATGG - Intronic
901160430 1:7173030-7173052 GTGGCTGGGGACAGGCTGTGCGG + Intronic
901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG + Intronic
902565028 1:17305725-17305747 CAGGCTGGTGACAGACGGTGGGG - Intergenic
903229526 1:21913439-21913461 GTCGAAGGTGACAGGCAGCGGGG - Intronic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
903619585 1:24688215-24688237 GTGACTGGTGACACAGAGAGGGG + Intergenic
904078471 1:27857252-27857274 GTGGCTGGTGAGTGGGAGCGGGG + Intergenic
905857644 1:41324666-41324688 GTGTCAGGTGAGAGACAGAGGGG + Intergenic
906406290 1:45545028-45545050 GTGGCTGCTGAGAGCCAGCAAGG - Intergenic
906648207 1:47491400-47491422 GTGGGTGGTGACAGCCAGAGAGG + Intergenic
909085448 1:71165455-71165477 GTGGGTGGTGACAGACATCAAGG - Intergenic
910506696 1:87957564-87957586 GTTGCTGGGGAGAGGCAGCGTGG - Intergenic
911117302 1:94259110-94259132 GTGGGTGGGGACAGGCAGTGGGG + Intronic
911183428 1:94881179-94881201 AGGCCTGGTGACAGACAGCCTGG - Intronic
912385047 1:109267291-109267313 GTGGCTGGAGACAGGCAGGATGG + Intronic
914172207 1:145235127-145235149 GTGACTGCTGACTGCCAGCGTGG + Intergenic
914506568 1:148295087-148295109 GTGGATTGTGACAGCCAGGGGGG - Intergenic
915058304 1:153157903-153157925 GTGGCAGGAGACAGAGAGGGGGG + Intergenic
915707263 1:157856794-157856816 TTGGCAGGTGTCACACAGCGGGG + Intronic
916824001 1:168426952-168426974 GTGGCTGGTGGCAGAGAGGGTGG + Intergenic
917968187 1:180191606-180191628 GTGGCAGGAGACAGACACAGAGG + Intronic
918738630 1:188098419-188098441 GTGGGAGGTGACTGACAGAGAGG - Intergenic
918888979 1:190239039-190239061 GTGGCAGGTGAAAGAGAGCGAGG + Intronic
919552904 1:199014200-199014222 ATGGCTGGTCACAGACAACAGGG - Intergenic
919823749 1:201489411-201489433 GTGGCTGTTGGCAGTCAGCCTGG - Intronic
919897495 1:202018390-202018412 GTGACTGGTGCCCGACAGAGAGG - Intergenic
920264597 1:204712331-204712353 GCAGCTGCTGACAGACAGCTGGG + Intergenic
920671997 1:208010819-208010841 GTGGATGGTGACTCACAGTGTGG - Intergenic
922951071 1:229558766-229558788 AAGGCGGGTGACAGCCAGCGGGG - Intergenic
923466676 1:234253917-234253939 CTAGCTGGTGACAGACAGAAAGG + Intronic
1067530601 10:47068915-47068937 GTGGCTGATGTCATACAGCTTGG + Intergenic
1072764364 10:98083716-98083738 GTGGCTGGGTACAGAAAGCCAGG - Intergenic
1072781157 10:98252735-98252757 GAGGCTGGTGCCTGACAGCAAGG + Intronic
1073078024 10:100836680-100836702 TTGGTTGGTGACAGACGGCTAGG - Intergenic
1074320008 10:112392968-112392990 GTGGCTGGTGGCAGACTGGATGG + Intronic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1076143634 10:128098903-128098925 GTGGGTGGTGACAGACCTCAAGG + Exonic
1076422415 10:130340705-130340727 GGGAGTGGTGACAGACAGCAGGG - Intergenic
1076424022 10:130354705-130354727 GTGGCTGGAGACCGAATGCGAGG + Intergenic
1076824679 10:132960914-132960936 GTCACTGGTGACAGACGGCGAGG + Intergenic
1077077488 11:708124-708146 GTGGCTGGTGACCCCCACCGTGG + Intronic
1077222516 11:1423920-1423942 GTGGCTGGGGACACACGGGGTGG - Intronic
1077994915 11:7444844-7444866 GTGGCTGGAGACAGACAAGAGGG + Intronic
1078972970 11:16436420-16436442 ATGGCTGTAGACAGAGAGCGAGG - Intronic
1080202520 11:29689463-29689485 TTGGATGGTGACAGAGAGGGAGG - Intergenic
1081731413 11:45374409-45374431 AAGGCTGGTTACAGACAGCAAGG - Intergenic
1083617353 11:64032897-64032919 GTGGCTGGTGTCAGCCAGGATGG - Intronic
1083871018 11:65488546-65488568 CTGGCTGGGGGCAGACAGGGAGG + Intergenic
1084228479 11:67732382-67732404 GTGGCTGGTAACATCCAGTGGGG + Intergenic
1085517452 11:77119654-77119676 GTGTGTGGTGACAGTCAGCATGG + Intronic
1089400077 11:118159461-118159483 GTGGCTGTTGACCGATAGAGTGG - Intergenic
1090554133 11:127855669-127855691 TTGGCTGGGGACAGTCAGGGAGG - Intergenic
1090688158 11:129148666-129148688 GCCACTGGTGACAGACAGGGAGG + Intronic
1092263301 12:6963553-6963575 GTGGCTGGTGGCGGGCAGCAGGG + Intergenic
1095651726 12:44619125-44619147 GTGGCTCTTGACAGACAGGGAGG + Intronic
1095781292 12:46063420-46063442 GTGGAAGGTTACAGACAGCAGGG + Intergenic
1096650304 12:53059155-53059177 GTCGCTGCTGACAGAGAGCATGG - Exonic
1097188658 12:57209178-57209200 GTGGCTGCTGACAGCAAACGAGG + Exonic
1099126168 12:78760989-78761011 GTGGCAGGAGACAGAGAGAGAGG + Intergenic
1101079719 12:101170735-101170757 GTGCCTGGTGACAGTCTGGGGGG - Intronic
1103034675 12:117646930-117646952 GTGGATGATTACAGCCAGCGGGG + Intronic
1104163420 12:126203041-126203063 GTGGTTGGTGACAGACAGATAGG + Intergenic
1104748191 12:131222958-131222980 TTGGCTGGGGACAGACAGTAGGG - Intergenic
1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1108090155 13:46841069-46841091 GTGGCAGGTGAGAGAGAGCGTGG - Intronic
1108511330 13:51158581-51158603 GTGCAAGGTGACAGACAGAGAGG - Intergenic
1110572917 13:77026477-77026499 GGGGCTGGTGACAGGCACCATGG - Intronic
1111251924 13:85612952-85612974 TTGGCTGGAGACAGTCAGAGGGG - Intergenic
1113002487 13:105658328-105658350 TGTGCTGGTGACAGACAGAGAGG - Intergenic
1113294858 13:108947667-108947689 GGGGGTGGAGACAGACAGGGTGG - Intronic
1113305531 13:109074478-109074500 GTGGCAGGAGACAGAGAGCAAGG + Intronic
1114170047 14:20263021-20263043 GGGGCTGCTGACACACAGCCAGG + Intronic
1117543197 14:56768798-56768820 GTGGTTGGTGTCATACAGCATGG + Intergenic
1118474279 14:66102284-66102306 TTGGCTGGGGACAGTCAGAGAGG + Intergenic
1118666390 14:68075192-68075214 TTGCCTGGTGACAAACAGAGGGG + Intronic
1120848305 14:89146024-89146046 GTGGTTAGTGACAGACAGACTGG - Intronic
1121176820 14:91896785-91896807 GTGTCAGGAGGCAGACAGCGTGG - Intronic
1121451007 14:94008288-94008310 GAGGCTGGGGACAGTCAGGGTGG + Intergenic
1122412417 14:101532488-101532510 GGGGATGGTGACAGGCATCGTGG + Intergenic
1122646097 14:103195207-103195229 GTGGCAGGAGAGAGACAGTGGGG - Intergenic
1122921331 14:104881595-104881617 GCAGCTGGTGACAGCCAGTGTGG + Intronic
1128234337 15:66057255-66057277 TTGGCTGGTGGCAGGCAGCTTGG + Intronic
1129231639 15:74200313-74200335 GAGGCAGGCGACAGGCAGCGTGG + Intronic
1130064657 15:80593822-80593844 GCGCCTGGGGACACACAGCGGGG - Exonic
1130349543 15:83078951-83078973 GTGGCTGGGCACAGACAGCTGGG - Intergenic
1132600211 16:769737-769759 GAGGGTGGGGACAGCCAGCGAGG + Intronic
1133528303 16:6627960-6627982 ATGGCTGTTGACATCCAGCGAGG - Intronic
1134213619 16:12298723-12298745 TTGGCCGGTGAGAGACAGCAAGG - Intronic
1134602340 16:15543189-15543211 TTGGCTGGGGACAGTCAGAGAGG - Intronic
1136041106 16:27579618-27579640 GTGCCTGGGGACACACAGCCAGG - Intronic
1136077336 16:27826209-27826231 GTGGCTGGGGAAAGACACAGTGG + Intronic
1138606889 16:58095325-58095347 GGGGGTGGTGGCAGACAGCTGGG + Intergenic
1140284347 16:73587505-73587527 GTGTCTGGTAACAGCCAACGCGG - Intergenic
1140541659 16:75761417-75761439 GCTGCTGGTGACAGCAAGCGAGG + Intronic
1142261215 16:89043310-89043332 GAGGGTGGTGGCAGACAGAGAGG - Intergenic
1143877523 17:10003424-10003446 GTGGCTGGTGACATATGGAGTGG - Intronic
1144124980 17:12194877-12194899 GGGCATGGTGACAGACAGCATGG - Intergenic
1145391795 17:22460910-22460932 GTGGCTGACTGCAGACAGCGTGG - Intergenic
1146922268 17:36721602-36721624 GAGGCTGCTGACAGGCAGTGTGG + Intergenic
1147503362 17:40987805-40987827 GGGGCAGGTGAGAGAGAGCGTGG - Intergenic
1151174355 17:72274936-72274958 ATGGCTGGGGTCAGACAGCAAGG + Intergenic
1151269214 17:72980014-72980036 GTGGCTGGGGACAGGAAGGGTGG - Intronic
1151464644 17:74276641-74276663 GTGTCTGGAGGCAGACAGAGGGG - Intronic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1154241319 18:12657135-12657157 GTGGCTGCTGACACACGGCCGGG - Intronic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1156684398 18:39627295-39627317 TTGGCTGGGGACAGTCAGAGAGG - Intergenic
1159890419 18:73948180-73948202 GTGGCAGACGACAGGCAGCGTGG + Intergenic
1159906061 18:74093339-74093361 GTGGCTGGTGCGTGTCAGCGAGG + Intronic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1160909047 19:1466438-1466460 CTTGCTGGCCACAGACAGCGGGG - Exonic
1161976068 19:7608211-7608233 GTGGATGGTGGCGGCCAGCGCGG - Exonic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1164575725 19:29404334-29404356 GTGGCTGTGGACAGGCAGAGAGG + Intergenic
1165074691 19:33274120-33274142 GTGGCTGGTGTCTGCCAGGGAGG + Intergenic
1165863651 19:38922756-38922778 GTGGCTGGAGACAGCCACAGGGG - Intronic
1166802202 19:45465259-45465281 CTGGCTGGTGGCAGACAGAGGGG + Intronic
926171081 2:10552982-10553004 GGGGCCGGAGACAGACAGCAGGG + Intergenic
927275950 2:21262652-21262674 GTGGCTGATGACAGGCAACTTGG + Intergenic
929916237 2:46138370-46138392 ATGGCTGGTAAGAGGCAGCGTGG - Intronic
929942180 2:46342609-46342631 GTTACTGGTGACAGACATCTTGG + Intronic
929995980 2:46826455-46826477 GTGGCTTGGGGCAGACAGTGAGG + Intronic
932459383 2:71872599-71872621 GGGGCTGGTGTCAGGCAGGGCGG + Intergenic
932743142 2:74307402-74307424 GTAGCTGGAGACAGAGATCGAGG - Intronic
933690496 2:85175863-85175885 GTGGCTGGTGACAGCGAGAAAGG - Intronic
934512652 2:94958818-94958840 GTGGGAGGTTACAGACAGCAAGG + Intergenic
934517831 2:94999772-94999794 GTGGCAGGTGACTGACCGCAGGG + Intergenic
934614406 2:95762384-95762406 GGTGCTGGTGCCAGGCAGCGGGG + Intergenic
936233941 2:110726844-110726866 GTGGCTGGTGTCAGACAACTGGG - Intergenic
937289502 2:120773715-120773737 GTGGCAGGTGGCAGGCAGCACGG + Intronic
938047875 2:128139611-128139633 TTGGCAGGTGACAGTCAGCAGGG + Intronic
938589072 2:132719943-132719965 GTGATTGGTGACACACAGCCAGG + Intronic
938693787 2:133816228-133816250 GTGGGTGGTGACAGGCTGGGAGG - Intergenic
940449361 2:153818389-153818411 TTGCCTGGTGAGAAACAGCGGGG - Intergenic
941161985 2:162045977-162045999 GGCGCTGGTGTCAGACAGAGTGG + Intronic
946173895 2:217911090-217911112 GTGGGTGGAGACAGACATAGGGG - Intronic
947798996 2:232915511-232915533 GTGGCTGGTGGCTGTCAGAGCGG + Intronic
948349225 2:237324564-237324586 CTGCCTGGAGACAGAGAGCGAGG + Exonic
1168810578 20:701926-701948 CTGTTTGGTGACAGACAGGGAGG - Intergenic
1170320629 20:15093925-15093947 GTGGCTGTTGACAGAGGGCAAGG - Intronic
1172689056 20:36778048-36778070 GTGGATGGTGCCAGCCAGGGAGG - Exonic
1172773793 20:37396017-37396039 CTGGCTGTTGAGAGACAGGGTGG + Intronic
1175187739 20:57190329-57190351 GAGGCTGGAGACAGTGAGCGAGG + Intronic
1175817107 20:61888931-61888953 GTGACTGGTGTCACACTGCGTGG - Intronic
1175910071 20:62401038-62401060 ATGGCTGGTAAGAGACAGAGTGG + Intronic
1176127292 20:63481754-63481776 GAGGCGGGTGGCACACAGCGGGG - Intergenic
1176887367 21:14272710-14272732 GTGGCTGCTGAGTGAGAGCGAGG + Intergenic
1178982760 21:37278575-37278597 GTCCCTGCTGACAGTCAGCGAGG - Intergenic
1179345042 21:40548178-40548200 GTGGCTGTTGACACAGTGCGAGG - Intronic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1180157164 21:45983335-45983357 GTGGCTGAGGACAGACCGGGGGG + Intronic
1180953448 22:19731018-19731040 GTGGCGGCTGACAGACGGGGCGG + Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1182051463 22:27315822-27315844 GAGGCTGGTCACAGACATTGGGG - Intergenic
1182548443 22:31088831-31088853 GTGGCAGGTGAGTGACAGGGAGG - Intronic
1183354425 22:37350739-37350761 GTGGCTGCCCACAGCCAGCGTGG - Intergenic
1184431958 22:44446336-44446358 TTAGCTGGTGACAGACACAGAGG - Intergenic
1184596459 22:45517043-45517065 GTGGCTGATGACTGATAGGGTGG + Intronic
949976918 3:9469164-9469186 GTGGCCTGTGACAGAAAGCCAGG - Intronic
950747556 3:15102506-15102528 GAGGGTGATGACAGACAGCCTGG + Intergenic
953026215 3:39146704-39146726 GGGTCTGGGGACAGACAGCCTGG + Exonic
953606197 3:44414901-44414923 TTGGCTGGTGAGAGACAAGGGGG - Intergenic
953800321 3:46017923-46017945 GTGGTCAGGGACAGACAGCGTGG + Exonic
955374550 3:58384153-58384175 GAGGCTGGTGACTCACAGTGTGG + Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
956206042 3:66755478-66755500 GTGCCTGGAGAAAGACAGTGTGG - Intergenic
959575041 3:107925220-107925242 TTGGCTGGGGACAGTCAGAGAGG - Intergenic
960449904 3:117793874-117793896 GTGGCTGGTGCCAGCAAGCTGGG - Intergenic
960508983 3:118525687-118525709 GAGGCTGGGGACAGTCAGAGAGG - Intergenic
960809389 3:121613503-121613525 TTGGCTGGTCACGGACAGCCGGG - Intronic
961395535 3:126585935-126585957 ATGGCTGCTGACTGACAGAGTGG + Intronic
961575760 3:127834937-127834959 GAGGCTGGAGACACACAGGGAGG + Intergenic
961824645 3:129592628-129592650 ATGGCTTGTGAAAGTCAGCGCGG - Intronic
962663471 3:137628921-137628943 GTGGCTGCTGACAGTTAGGGTGG + Intergenic
963561031 3:146865348-146865370 GTGGCTGGTGCCAGAATGAGAGG + Intergenic
964132960 3:153311760-153311782 GTCGGTGGTGTCAGACAGCCTGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969309850 4:6346899-6346921 GGTGCTGGGGACAGACAGTGAGG + Intronic
973083216 4:46021801-46021823 GTGACTGGTGTCAGACATTGGGG - Intergenic
978323410 4:107523472-107523494 GTGACTGGTGAGGGGCAGCGTGG + Intergenic
978699122 4:111621787-111621809 GTGGCAGGTGAGAGAGAGGGTGG + Intergenic
980079611 4:128330088-128330110 GTGGATGGTGACTGGCAGCAAGG - Intergenic
980203817 4:129691712-129691734 GTGGCAGGTGAAAGAGAGTGAGG + Intergenic
980694521 4:136337729-136337751 CTGCCTGGTGACAAACAGTGGGG - Intergenic
983699059 4:170568922-170568944 GTGGCAGGAGAGAGAGAGCGAGG - Intergenic
984411065 4:179398672-179398694 GTGGAGGGTGACAGAAAGTGAGG - Intergenic
986091519 5:4512899-4512921 GTGGGTGATGAAAGAAAGCGAGG - Intergenic
986592568 5:9386604-9386626 GTGGCTGGTGTCAGCCACCATGG - Intronic
987201586 5:15583117-15583139 GTGGCAGGTGAGAGAGAGCAGGG + Intronic
989012217 5:36885793-36885815 GTAGCTAGAGACAGACATCGAGG + Intronic
990907557 5:60820125-60820147 GTGGCCTCTGACAGACAGCCTGG + Intronic
992215113 5:74518265-74518287 GTGGCTGATGTCACACAGCAGGG - Intergenic
992992504 5:82298503-82298525 TTGGCTGGGGACAGTCAGAGAGG - Intronic
997366496 5:133328699-133328721 GGGGCTGGTGACAGGGAGAGTGG - Intronic
997424006 5:133790752-133790774 GTGGGATGTGAGAGACAGCGGGG - Intergenic
997476035 5:134143105-134143127 GTGCCTAGTGACACACAGCAGGG + Intronic
998031277 5:138870729-138870751 TTGTCAGGTGACAGACAGCTTGG - Exonic
998415916 5:141945915-141945937 ATGGCAGGGGACAGACAGAGTGG + Intronic
999694014 5:154172404-154172426 GTGGCTGGAGTCAGACACCCTGG + Intronic
999939626 5:156527798-156527820 GTGGCTGGTGACAGGAAGATTGG - Intronic
1002194457 5:177494678-177494700 GTGGCTGGAGAGAGGCAGGGAGG + Intronic
1002564145 5:180100509-180100531 GGGGCTGGAAACAGACAGGGTGG + Intergenic
1003351984 6:5326539-5326561 CTGGCTGGTGCCAGTCAGGGCGG - Intronic
1003395510 6:5749279-5749301 GTGGCTGGGGACAGGCAGGCTGG + Intronic
1004280179 6:14273958-14273980 GTGGCAAGTGACTGACAGCCTGG - Intergenic
1006075187 6:31528076-31528098 GTGGCTGCTGCCAGACAGAAAGG - Intergenic
1006435187 6:34022458-34022480 AGGGCTGGAGACAGACAGAGGGG + Exonic
1007621865 6:43220418-43220440 GGGGCTGCTCACAGACAGTGTGG - Intronic
1007959232 6:45943419-45943441 GTGGCTGGGGGCACACAGCAGGG + Intronic
1008270949 6:49489000-49489022 ATGGCTGCTGACTGATAGCGTGG + Intronic
1011901597 6:92304600-92304622 GTGGCAGGTGAAAGAGAGCAAGG - Intergenic
1013668218 6:112369854-112369876 TTGACTGGTGATAGACAACGGGG - Intergenic
1014174443 6:118316152-118316174 GTGGGTGCTGACAGACAGTGTGG - Exonic
1016920477 6:149288411-149288433 GGACCTGGTGACAGACAACGGGG - Intronic
1019129175 6:169860810-169860832 GTGGCAGGAGAGAGACAGCAGGG - Intergenic
1020570235 7:9850992-9851014 GTGGCTGGTGACAGAAAAGATGG + Intergenic
1020775323 7:12446231-12446253 GTGTCAGGTGACAGACAAAGGGG + Intergenic
1022462087 7:30619153-30619175 GAGTCTGGTGTCAGACAGCCAGG - Intronic
1023109874 7:36798999-36799021 ATGGCTGGTGAGAGGCAGTGAGG + Intergenic
1023268998 7:38439097-38439119 GTGGCAGGAGAGAGACAGCAGGG - Intronic
1023650215 7:42361659-42361681 GTGGCTGATGGCAGGCAGCAGGG + Intergenic
1025019680 7:55471226-55471248 GTGACTGCTGACTGCCAGCGTGG - Exonic
1027560095 7:79718748-79718770 GTGGCAGGTGAGAGAGAGAGAGG + Intergenic
1027820973 7:83044129-83044151 GTGGCAGGGGAGAGACAGCAAGG + Intronic
1028530411 7:91832087-91832109 TTGGCTGGGGACAGGCAGAGAGG - Intronic
1032238672 7:130144445-130144467 GTTGCTGGTTACACACAGCGAGG - Intergenic
1032608314 7:133382904-133382926 TTGTCTGGAGACAGACAGTGAGG + Intronic
1033543298 7:142376590-142376612 GTGGGTGCTGCCAGACAGAGGGG + Intergenic
1033767081 7:144505772-144505794 TTGGCTGGGGACAGTCAGAGAGG + Intronic
1034997840 7:155589652-155589674 GAGGCTGGTGCCAGGCAGCACGG - Intergenic
1037001940 8:13730468-13730490 GTTGCAGTTGACAGACAGTGGGG - Intergenic
1040111335 8:43568372-43568394 GTGGATGGGGACAGGCAGCCAGG - Intergenic
1040636701 8:49283695-49283717 GTGGTTGTTGACAGAGAGCAGGG + Intergenic
1041019501 8:53624153-53624175 GTGGGTGGGGACACACAGAGAGG + Intergenic
1042522951 8:69733713-69733735 GTGGCAGGTGAAAGAGAGTGAGG - Intronic
1045811474 8:106224920-106224942 GTGGGTGGTGACAGACTGTATGG + Intergenic
1046520937 8:115324772-115324794 GAGGCTGTTGACAGCCAGAGAGG + Intergenic
1048031378 8:130636437-130636459 GGGGCTGGTGACAGAAAGTGAGG + Intergenic
1049808166 8:144550764-144550786 GTGGATGGTGGCAGCCAGTGTGG + Intronic
1049976394 9:864002-864024 CTGGCGGGGGACAGACTGCGGGG + Intronic
1052231930 9:26164639-26164661 TTGGCTGGGGACAGTCAGAGAGG + Intergenic
1053412072 9:37922439-37922461 TTGGCTGCCGACAGATAGCGAGG + Intronic
1054147741 9:61575251-61575273 GTGGCTGGTGTCTGAAAGGGGGG + Intergenic
1054652646 9:67636775-67636797 GTGGCTGGTGTCTGAAAGGGGGG + Intergenic
1060544372 9:124451632-124451654 GGAGCAGGTGACAGACAGCAGGG - Intronic
1061657006 9:132099907-132099929 GGGGCTGGGGACAGTCAGGGAGG + Intergenic
1062183483 9:135203579-135203601 GGGGCTGGGGAAAGACAGCAGGG - Intergenic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1186031732 X:5376054-5376076 GTGGCTGGGGACAGTCAGAGAGG + Intergenic
1188437548 X:30179590-30179612 TTGGCTGGGGACAGTCAGAGAGG + Intergenic
1189928644 X:45983952-45983974 GTAGCTGGAGACAGAGATCGAGG + Intergenic
1190734521 X:53247197-53247219 GTTGCTGGTGCCAGACTGGGTGG - Intronic
1198312879 X:135437723-135437745 GAGACAGGTGGCAGACAGCGAGG + Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1199508831 X:148596962-148596984 TTGTCTGGTGACAGACAGACAGG - Intronic
1200139603 X:153892794-153892816 GTGGGTAGTGACAGGCACCGTGG - Intronic