ID: 1076017515

View in Genome Browser
Species Human (GRCh38)
Location 10:127040014-127040036
Sequence CGTGCAGCTCCATCTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076017508_1076017515 7 Left 1076017508 10:127039984-127040006 CCTGCCCCACTGCAGCTCCGCAG 0: 1
1: 1
2: 4
3: 43
4: 412
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017510_1076017515 2 Left 1076017510 10:127039989-127040011 CCCACTGCAGCTCCGCAGCCCAA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017505_1076017515 23 Left 1076017505 10:127039968-127039990 CCTTCAGGTGCTCGCCCCTGCCC 0: 1
1: 0
2: 0
3: 25
4: 297
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017511_1076017515 1 Left 1076017511 10:127039990-127040012 CCACTGCAGCTCCGCAGCCCAAT 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017507_1076017515 8 Left 1076017507 10:127039983-127040005 CCCTGCCCCACTGCAGCTCCGCA 0: 1
1: 0
2: 1
3: 26
4: 326
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017512_1076017515 -10 Left 1076017512 10:127040001-127040023 CCGCAGCCCAATACGTGCAGCTC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017509_1076017515 3 Left 1076017509 10:127039988-127040010 CCCCACTGCAGCTCCGCAGCCCA 0: 1
1: 0
2: 2
3: 24
4: 338
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017503_1076017515 27 Left 1076017503 10:127039964-127039986 CCCTCCTTCAGGTGCTCGCCCCT No data
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017506_1076017515 9 Left 1076017506 10:127039982-127040004 CCCCTGCCCCACTGCAGCTCCGC 0: 1
1: 0
2: 4
3: 48
4: 477
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data
1076017504_1076017515 26 Left 1076017504 10:127039965-127039987 CCTCCTTCAGGTGCTCGCCCCTG 0: 1
1: 0
2: 0
3: 8
4: 170
Right 1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076017515 Original CRISPR CGTGCAGCTCCATCTCCCTG TGG Intronic
No off target data available for this crispr