ID: 1076019093

View in Genome Browser
Species Human (GRCh38)
Location 10:127055777-127055799
Sequence CCATGCCAGTGGATCACTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2521
Summary {0: 1, 1: 0, 2: 8, 3: 254, 4: 2258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076019093_1076019099 6 Left 1076019093 10:127055777-127055799 CCCTAAGTGATCCACTGGCATGG 0: 1
1: 0
2: 8
3: 254
4: 2258
Right 1076019099 10:127055806-127055828 CCTACCAGGTTACATAGAAATGG No data
1076019093_1076019097 -8 Left 1076019093 10:127055777-127055799 CCCTAAGTGATCCACTGGCATGG 0: 1
1: 0
2: 8
3: 254
4: 2258
Right 1076019097 10:127055792-127055814 TGGCATGGTTTAGTCCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076019093 Original CRISPR CCATGCCAGTGGATCACTTA GGG (reversed) Intronic
Too many off-targets to display for this crispr