ID: 1076019719

View in Genome Browser
Species Human (GRCh38)
Location 10:127062635-127062657
Sequence AGAAGGGATTTCACTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076019719_1076019720 -9 Left 1076019719 10:127062635-127062657 CCATGTGTAGTGAAATCCCTTCT 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1076019720 10:127062649-127062671 ATCCCTTCTTCCTCCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076019719 Original CRISPR AGAAGGGATTTCACTACACA TGG (reversed) Intronic
901955090 1:12778292-12778314 GGAAAGGATTTCACTGCACAAGG + Intergenic
902254930 1:15182253-15182275 AGCAGGGATTTGACTCCAGAAGG - Intronic
903203977 1:21766617-21766639 GGTAGGGATTTCACTCCAAATGG + Intronic
905451988 1:38062894-38062916 TGGAGGGACTTCACTTCACAAGG - Intergenic
907550442 1:55300414-55300436 GGTAGAGATTTCACTGCACAAGG + Intergenic
911455433 1:98116601-98116623 AGAAGAGGTTTCCCTACAGAAGG + Intergenic
912681331 1:111730914-111730936 AGACGGTAACTCACTACACAGGG + Intronic
913608687 1:120490114-120490136 AGCAGGGATCTCAGCACACAGGG - Intergenic
913688730 1:121258160-121258182 AGAAAGGATTTCAGGCCACAAGG - Intronic
913986743 1:143572562-143572584 AGCAGGGATCTCAGCACACAGGG + Intergenic
914148870 1:145022116-145022138 AGAAAGGATTTCAGGCCACAAGG + Intronic
914205144 1:145520337-145520359 AGCAGGGATCTCAGCACACAGGG + Intergenic
914370433 1:147019892-147019914 AGCAGGGATCTCAGGACACAGGG - Intergenic
914484261 1:148093518-148093540 AGCAGGGATCTCAGGACACAGGG + Intergenic
914582510 1:149031724-149031746 AGCAGGGATCTCAGCACACAGGG + Intronic
916492599 1:165315170-165315192 AGAAAGACTTTCACTAAACAGGG - Intronic
918948170 1:191097847-191097869 AGAAGGGATTTCTCTGTATAAGG - Intergenic
924643608 1:245857049-245857071 AGCAGGCATTTCACTGCTCATGG + Intronic
1066230937 10:33432556-33432578 AGGAGATATTACACTACACAGGG + Intergenic
1067807078 10:49400046-49400068 AGAAATGACTTCAGTACACATGG + Intergenic
1068572991 10:58651536-58651558 ACACTGAATTTCACTACACAGGG - Intronic
1073459051 10:103655146-103655168 AGAAGGGCTGTCAGTGCACAAGG + Intronic
1074889385 10:117722559-117722581 AGAAGGGTTTTATCTACTCAAGG + Intergenic
1076019719 10:127062635-127062657 AGAAGGGATTTCACTACACATGG - Intronic
1079367761 11:19824225-19824247 AGAAGGGATATGACTCCCCAAGG + Intronic
1080289426 11:30654290-30654312 AGTATGGATTAGACTACACAGGG + Intergenic
1080675697 11:34424415-34424437 GGAAGGGATGTGAGTACACAGGG - Intergenic
1085491851 11:76927341-76927363 AGAAGTGATTTCACTACGTTAGG - Intronic
1086754452 11:90542270-90542292 AGATGGCACTTCACTACACTTGG - Intergenic
1089450682 11:118593922-118593944 AGAAGGTACTTCACTTCAGAGGG + Intronic
1095286524 12:40417840-40417862 AGAAAAGAGTTCAGTACACAGGG - Intronic
1096880274 12:54662004-54662026 AAAAAGGATTTCCCTACACAGGG - Intergenic
1098564781 12:71921421-71921443 AGAAGCAATTTCTCTACAGATGG + Exonic
1098749643 12:74278032-74278054 AGGAAGGATTCCACTACATATGG + Intergenic
1100701639 12:97154779-97154801 AGAGGGGATTTCTATAGACATGG + Intergenic
1104611111 12:130228559-130228581 AGAAGGGAATACAGGACACATGG - Intergenic
1105632110 13:22179861-22179883 TGAAGGCATTTCTCTACACAAGG - Intergenic
1106457571 13:29940436-29940458 AGATGGGGTTTCACTACATTGGG - Intergenic
1107403981 13:40095861-40095883 AGAAGGGATTAGAACACACAAGG - Intergenic
1107824268 13:44313272-44313294 AGAAAGGGTTTCACTCAACAAGG - Intergenic
1108877914 13:55071293-55071315 AGATGGGGTTTCACTACATTGGG + Intergenic
1109637306 13:65138955-65138977 ATATGTGAGTTCACTACACAAGG - Intergenic
1110265390 13:73531512-73531534 AAAAGGGATTTCAGTCCAGAAGG - Intergenic
1112547183 13:100382313-100382335 AGAAGGGACTTGACTTCAGAGGG - Intronic
1112719008 13:102220941-102220963 ATAAGGAAATGCACTACACAGGG + Intronic
1113272259 13:108686326-108686348 AAAAAGGATTGCACTGCACATGG - Intronic
1115842028 14:37482920-37482942 ACAAGGGATTTGACTATCCATGG - Intronic
1116817031 14:49593559-49593581 AGCTGGGATTACACTACACCTGG - Intronic
1118104925 14:62647614-62647636 AGAAGGGGTTCCACAACGCAAGG + Intergenic
1119541922 14:75444759-75444781 AATAGGTAGTTCACTACACATGG - Intronic
1120030230 14:79632437-79632459 AGAAGGGAATTCAGGACAGAGGG + Intronic
1120146137 14:80981189-80981211 ATCAGGGATTTCACTGCTCAGGG + Intronic
1120348419 14:83320850-83320872 ACAAAGGATTTCATTACTCATGG + Intergenic
1126803242 15:52319769-52319791 AAAAGGAACTTCACTACAAAAGG + Intronic
1127850440 15:62907368-62907390 AGAAGCGATTTCACTGCAGCTGG + Intergenic
1128719943 15:69940895-69940917 AGAAGTGATTTTAATTCACATGG - Intergenic
1132524760 16:408479-408501 AGACGGAATTTCAGGACACAAGG - Intronic
1133518482 16:6532854-6532876 AGAAGGGTCTTCAATTCACATGG - Intronic
1135320428 16:21492313-21492335 AGACGGGGTTTCACTACATTGGG - Intergenic
1135373263 16:21923803-21923825 AGACGGGGTTTCACTACATTGGG - Intergenic
1135438526 16:22446899-22446921 AGACGGGGTTTCACTACATTGGG + Intergenic
1138423791 16:56916897-56916919 AGAAGGGAATTCAGTCCACATGG - Intergenic
1138932729 16:61680485-61680507 AGAAGGAATTTACCTACAGAAGG - Intronic
1140122972 16:72099223-72099245 AGAAGGAATTTCATTTGACACGG + Exonic
1140677466 16:77346955-77346977 AGAAGGGAATTGACTGCAAAAGG - Intronic
1141022952 16:80515103-80515125 AGAAGGAATTTCAGGACAGAGGG - Intergenic
1142921184 17:3188274-3188296 AGAAGGGATTTAACCAAACCTGG + Intergenic
1146138791 17:30346951-30346973 AGAAGATATTTCCCTTCACATGG - Intergenic
1151104944 17:71602354-71602376 AGAATGGATATTTCTACACACGG - Intergenic
1153560716 18:6369507-6369529 AGAAGGGATCACTCTATACAAGG + Intronic
1154350900 18:13582547-13582569 AGGAGGCATTTGACAACACATGG + Intronic
1158213965 18:55079991-55080013 AGAAGAGAGTTCACTTCAAAAGG - Intergenic
1158511539 18:58094918-58094940 AGAAGGGATTTCCCTGTTCATGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1158882351 18:61792668-61792690 AGAAAGTATTAAACTACACAGGG + Intergenic
1161876121 19:6911225-6911247 AAAAAGGATTTCAATAAACACGG - Intronic
1163059397 19:14747615-14747637 AGAAAGGATTTCACCACACTGGG - Intronic
1167016810 19:46846345-46846367 GGAAGGGAAGTCACTCCACAGGG - Intronic
927593240 2:24374882-24374904 AGAAGGGATTTCACCATATTGGG + Intergenic
928213568 2:29342383-29342405 TGTATGGATTTCACTACACAAGG - Intronic
935048735 2:99505670-99505692 AAAAGGGACTTAAATACACAAGG + Intergenic
936929500 2:117772949-117772971 TGAAGGGATTTCTCAATACAAGG + Intergenic
937076299 2:119109500-119109522 AGACGGGATTTCACCACATTGGG - Intergenic
939895771 2:147789620-147789642 AGAAGGGACTTCTCTACCCCTGG + Intergenic
942631458 2:177954594-177954616 AAAAGGGATTTCATTGCCCAGGG + Intronic
946871435 2:224089133-224089155 AGAAGTTTTCTCACTACACAAGG - Intergenic
948059932 2:235035310-235035332 AGAAGGGGTTTCACTAATAAGGG - Intronic
948191947 2:236066049-236066071 AGAAGGGTTTTCAGGACACATGG - Intronic
1169703496 20:8475662-8475684 GTAAAGGATTTCACTTCACATGG + Intronic
1169959305 20:11141245-11141267 AGTATAAATTTCACTACACAAGG - Intergenic
1171315779 20:24193394-24193416 AGATGTGATTTCACTACTTAAGG + Intergenic
1173689199 20:44946393-44946415 AGAAGGGTTTTAATTACAAAGGG + Intronic
1175432332 20:58914369-58914391 AGGAGGGATTTCACTTTAGATGG + Intergenic
1175855762 20:62120103-62120125 AGAAGGACTTTGACTCCACATGG + Intergenic
1177072456 21:16527538-16527560 AGAATGTATTTCAATACAAATGG + Intergenic
1177265787 21:18781632-18781654 AGAAGGGATATTACTCCAGAAGG - Intergenic
1181787409 22:25237152-25237174 AGAAGAGATTTCTTTACAGATGG + Intergenic
950581437 3:13864920-13864942 AGAATGGATTTCGCTGCCCATGG + Intronic
950958015 3:17075675-17075697 ATAAAGGATTTTACTACAAAGGG - Intronic
951037261 3:17947488-17947510 AGAAAGGATATCATGACACAAGG + Intronic
952457427 3:33486768-33486790 ATAAGGGATTTCCCTTCACTTGG - Intergenic
953447793 3:42982445-42982467 AGCTGAGATTTCACCACACATGG + Intronic
954055967 3:48025474-48025496 AGACGGGTTTTCACCACACCGGG + Intronic
955697642 3:61652811-61652833 AGAAGGCATTTGACTACCCCTGG - Intronic
960832669 3:121866164-121866186 AGAAGGGACTTCACCAGGCAAGG - Intronic
962102894 3:132361187-132361209 ACAAGGGATATCACTGAACAAGG - Intronic
962824852 3:139091397-139091419 ACAAAGGATTTCACTACTCATGG + Intronic
967099682 3:186206194-186206216 AGACGGGATTTCACCACGTAGGG - Intronic
969215308 4:5717350-5717372 AGCAGGGAACGCACTACACAGGG - Intronic
975435004 4:74342085-74342107 GAATGGGAGTTCACTACACAGGG + Intergenic
980323465 4:131309172-131309194 AGAAGGGGTTTCACCACGCTGGG - Intergenic
981392039 4:144202368-144202390 AGAAGGGATGTGACAATACAAGG - Intergenic
981720869 4:147800139-147800161 AGAAGGGATTTCCCTAGGCTGGG + Intronic
981901658 4:149872195-149872217 AGTAGGGAATTGACTACAGAGGG - Intergenic
982090987 4:151879773-151879795 AGAAGGGAAAACACTACCCAGGG - Intergenic
982374931 4:154679386-154679408 AGACGGGGTTTCACTACATTGGG + Intronic
983431651 4:167659010-167659032 AAATGGGATTTCCCTTCACATGG - Intergenic
984033327 4:174633081-174633103 AGATGGGATTTCACCACATTGGG - Intergenic
985066921 4:186131406-186131428 AGAAGGCATTTGAGCACACAGGG + Intronic
985837988 5:2284322-2284344 AGCAAGGACTTCATTACACACGG + Intergenic
986607021 5:9532605-9532627 AGAAGGCATTTCTCTAGACATGG + Intronic
987591931 5:19941224-19941246 AAAAGGGTGTTCACTAGACATGG + Intronic
988525564 5:31984104-31984126 GGAAGGGTATTCAATACACAGGG + Intronic
990874682 5:60471128-60471150 AGAAGTGATTCCACTTCTCATGG + Intronic
995502922 5:112828219-112828241 AGACGGGGTTTCACCACACCTGG + Intronic
995675627 5:114659611-114659633 AGATGGTATCTCATTACACATGG + Intergenic
1000600569 5:163269649-163269671 AGATGGGATTTCACAGGACATGG - Intergenic
1003275959 6:4653365-4653387 AGAAGTGATTTCACTCCTCCAGG - Intergenic
1004882884 6:20026013-20026035 AGGAGGGATTTGACCACACTAGG - Intergenic
1007089926 6:39177405-39177427 AGGAAGCATTTCACTAAACAAGG + Intergenic
1013602080 6:111714464-111714486 AGAAGGGAGATTATTACACAAGG + Intronic
1014150055 6:118044244-118044266 AGAAGAGGTTTCCCCACACAGGG - Intronic
1015910551 6:138164403-138164425 AAAAGGGAATTCCCTACAGAAGG - Intronic
1017276784 6:152578952-152578974 AGAAGAGATTTGACTTCATATGG + Intronic
1017740319 6:157400511-157400533 AGAATAGAGTTCACTACACATGG - Intronic
1018573484 6:165234165-165234187 AGAAAGGACTTCACCCCACATGG + Intergenic
1019679322 7:2336517-2336539 AGAAGGGATTTCACTGCGTTAGG - Intronic
1020853901 7:13392834-13392856 AGAAGCAATTTCACAACACTGGG + Intergenic
1021442926 7:20699511-20699533 AGATGGGGTTTCACTATACTGGG - Intronic
1022397388 7:30001508-30001530 AGATGGGGTTTCACTAGAGATGG - Intergenic
1022979336 7:35589449-35589471 AGAAGGGATGTCACACCACCAGG - Intergenic
1023530379 7:41147287-41147309 AAAAGGGAATTGGCTACACAGGG + Intergenic
1027212001 7:76157193-76157215 AGAAGGCCTTTCTCTACTCATGG - Intergenic
1029027854 7:97436785-97436807 AGAAGGGAGTTCCCTAGACATGG - Intergenic
1030696868 7:112595108-112595130 AGACAGGAGCTCACTACACATGG - Intergenic
1030697323 7:112600037-112600059 AGACAGGAGCTCACTACACATGG + Intergenic
1031888049 7:127261254-127261276 GCAAGTGATTACACTACACAAGG + Intergenic
1033100491 7:138466133-138466155 AGCTGGGATTACACTACACCTGG + Intronic
1033343249 7:140508073-140508095 AGAAGGGAGTTGCCTTCACAAGG - Intergenic
1033390275 7:140920754-140920776 AGAAGGGAGTTCAGTAAATAAGG + Intronic
1034948827 7:155282977-155282999 AGAAAGAATTTCACCACACTTGG + Intergenic
1036013307 8:4752679-4752701 AAATGGGATTGCTCTACACAGGG + Intronic
1037162583 8:15791012-15791034 AGAAGAGATTGCAGTACTCAAGG + Intergenic
1038403439 8:27304235-27304257 AGAATGAATTTCATTGCACAAGG + Intronic
1042826738 8:72987123-72987145 TGAAGTGCTTTCACTACTCAAGG + Intergenic
1045734535 8:105279668-105279690 AGATAGTATTTCACTACACGTGG + Intronic
1048469375 8:134693815-134693837 ACAAGGCATTTCATTACAAAGGG + Intronic
1050689187 9:8205916-8205938 GGAAGGGATTTGAATTCACATGG + Intergenic
1054943017 9:70764424-70764446 AGCTGGGATTTCATTACAGATGG - Intronic
1055397123 9:75888151-75888173 AGAAGGGTTGCCACTACATAAGG - Intergenic
1056270521 9:84944027-84944049 AGAAGAGATTCCACTATTCATGG - Intronic
1057976218 9:99608896-99608918 AGAAAGGATTTCCCTCCAAAGGG + Intergenic
1061324575 9:129855765-129855787 AGAAAGGATTCCAGTAGACACGG + Intronic
1185552866 X:997933-997955 AGAAGGGATTTTACAGCCCAGGG - Intergenic
1186062590 X:5726224-5726246 AGAAGCGATTTCTCAAGACAGGG + Intergenic
1186411400 X:9347551-9347573 AGCAGGGATTTTACCCCACAAGG + Intergenic
1187245534 X:17550182-17550204 AGAAAGGAATTCACGTCACAGGG + Intronic
1188722702 X:33543214-33543236 CGAAGGCATTGCTCTACACAGGG + Intergenic
1191684146 X:63871432-63871454 AGAAGGGAATTCACTAGGAAAGG + Intergenic
1195105514 X:101599168-101599190 AGGAGGGATAGAACTACACAGGG - Intergenic
1195107368 X:101614599-101614621 AGGAGGGATAGAACTACACAGGG + Intergenic
1196176501 X:112644569-112644591 AGTAGGCATATCACAACACAGGG + Intronic
1196413926 X:115450430-115450452 AGAAAGGAGTTGACTACAAAGGG + Intergenic
1197721121 X:129745367-129745389 AGAAGGGTTTTCTCTACAGTAGG - Intronic
1197899037 X:131348742-131348764 AAGAGTGATTTCACTCCACATGG + Intronic
1198755795 X:139981225-139981247 AGAAGTTAATTCATTACACAGGG + Intergenic
1200359750 X:155592252-155592274 AGAAAGGAGTTCAAGACACATGG + Intronic
1200786487 Y:7264861-7264883 AGACGGGATTTCACCACATTAGG - Intergenic
1201733921 Y:17236623-17236645 AGAAGGGAACTCAGCACACAAGG + Intergenic