ID: 1076021557

View in Genome Browser
Species Human (GRCh38)
Location 10:127077848-127077870
Sequence CACCCACCCCTCAAAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 243}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076021557_1076021563 5 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021563 10:127077876-127077898 TGAGATGGGGGAGCATTCCATGG No data
1076021557_1076021571 23 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021571 10:127077894-127077916 CATGGAGGGGCAGGAGGGTATGG No data
1076021557_1076021559 -10 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021559 10:127077861-127077883 GGGGTGGGTGTGAGTTGAGATGG No data
1076021557_1076021568 17 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021568 10:127077888-127077910 GCATTCCATGGAGGGGCAGGAGG No data
1076021557_1076021566 10 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021566 10:127077881-127077903 TGGGGGAGCATTCCATGGAGGGG No data
1076021557_1076021572 27 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021572 10:127077898-127077920 GAGGGGCAGGAGGGTATGGATGG No data
1076021557_1076021564 8 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021564 10:127077879-127077901 GATGGGGGAGCATTCCATGGAGG No data
1076021557_1076021560 -9 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021560 10:127077862-127077884 GGGTGGGTGTGAGTTGAGATGGG No data
1076021557_1076021561 -8 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021561 10:127077863-127077885 GGTGGGTGTGAGTTGAGATGGGG No data
1076021557_1076021569 18 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG No data
1076021557_1076021565 9 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021565 10:127077880-127077902 ATGGGGGAGCATTCCATGGAGGG No data
1076021557_1076021567 14 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021567 10:127077885-127077907 GGAGCATTCCATGGAGGGGCAGG No data
1076021557_1076021573 28 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021573 10:127077899-127077921 AGGGGCAGGAGGGTATGGATGGG No data
1076021557_1076021562 -7 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021562 10:127077864-127077886 GTGGGTGTGAGTTGAGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076021557 Original CRISPR CACCCACCCCTCAAAGCTCA GGG (reversed) Intronic
901153815 1:7122334-7122356 CCCCCACCCCTAAGAGCTCCAGG + Intronic
901263562 1:7892018-7892040 CACCCATCCCTCAAGATTCAGGG + Intergenic
901301489 1:8202842-8202864 CACACACCTGTCAAAGCACAGGG - Intergenic
903816325 1:26066952-26066974 CACCCTCCTCCCAAAGCTCTGGG + Intronic
903827168 1:26154882-26154904 CACCCACCGCCCAAGACTCACGG - Intergenic
904662545 1:32095922-32095944 CTCCCACCCCTCAGAGCCCAAGG - Intronic
904704703 1:32381056-32381078 CACCCACCCCACAAAGTATAAGG + Intronic
904861425 1:33540912-33540934 GACCCTCCCCTCAATGTTCATGG + Intronic
905374976 1:37514292-37514314 CCCCCTCCCCGCAAAGATCACGG + Intronic
909037679 1:70612742-70612764 CACCCACCTCTCAAAGGATATGG + Intergenic
910287496 1:85571922-85571944 CACCCAACATTCAATGCTCAGGG + Intronic
915312453 1:155011378-155011400 CACCTACCCTTCAGTGCTCAAGG - Intronic
916422673 1:164651221-164651243 CACCCCCTCCCCAAAGCTGAAGG - Intronic
916706419 1:167355743-167355765 CTCCCACCTCTCAAATCTCTGGG + Intronic
919873738 1:201845264-201845286 CTCCCACCTCTCAAAGTTCTGGG + Intronic
920724880 1:208425384-208425406 CTCCCATCCCTCATTGCTCAAGG - Intergenic
921575139 1:216826384-216826406 CAGCTAACACTCAAAGCTCAAGG - Intronic
921931669 1:220759565-220759587 CACCCACCCGGGAAAGCTTATGG - Intronic
922465952 1:225845721-225845743 CCCCCACCCCTCCCAGCGCAGGG + Exonic
924038227 1:239957402-239957424 CACCCAGCCCTCAGGGCACATGG - Intergenic
924826453 1:247544586-247544608 CACCCACCTCTCAAAGTGCTGGG - Intronic
1062814411 10:489132-489154 CACTCAGGCCCCAAAGCTCATGG + Intronic
1062826498 10:572816-572838 CTCCCTCCCCTCAAAGACCAGGG + Intronic
1065152024 10:22831637-22831659 CCCCTACCCCTCATAGCTCCTGG - Intergenic
1065498026 10:26349989-26350011 TACCCACCTCTCAACCCTCATGG + Intergenic
1068688102 10:59889759-59889781 CACCCACATCTCAAGGCCCAGGG + Intronic
1069788444 10:71004547-71004569 CATCCACCTCTCAAAACTCCGGG + Intergenic
1072278022 10:93841860-93841882 CTCCCACCTCTCAAAGCACTGGG + Intergenic
1072735057 10:97873615-97873637 CACCCTCCCCACAAATCTAAGGG - Intronic
1073737156 10:106362083-106362105 CACCCACCTCTCAAATTTCTGGG - Intergenic
1074323068 10:112421447-112421469 CACCGCCCCCTCCAAGTTCAAGG + Intronic
1075011513 10:118874349-118874371 CACCTACATCTCATAGCTCACGG - Intergenic
1075083361 10:119398294-119398316 CATGCACCCCTTTAAGCTCAGGG - Intronic
1076021557 10:127077848-127077870 CACCCACCCCTCAAAGCTCAGGG - Intronic
1076364562 10:129913758-129913780 CACCCACCCTTCAGAGCAAATGG + Intronic
1076781957 10:132729324-132729346 CACACAGCCCTCAACCCTCATGG + Intronic
1077043034 11:532951-532973 CAGCAGCCCCTCAAAGGTCAGGG + Intronic
1077120451 11:905120-905142 AACCCTCCCCTCACAGCCCAAGG + Intronic
1077146970 11:1050714-1050736 CACCTACCCCTCGAACCGCAGGG - Intergenic
1077245027 11:1532619-1532641 CTCCCAACCCGCAAAGGTCACGG + Intergenic
1078386558 11:10898294-10898316 CATCTTCCCCTAAAAGCTCAGGG - Intergenic
1079116506 11:17643645-17643667 CACCCACACCACAGGGCTCACGG + Intronic
1082162630 11:48901118-48901140 CACCCGCCCCTGCCAGCTCAGGG + Intergenic
1082175025 11:49049116-49049138 CACCCGCCCCTGCTAGCTCAGGG + Intergenic
1082243354 11:49892711-49892733 CACCCGCCCCTGCGAGCTCAGGG + Intergenic
1082657850 11:55873537-55873559 CACCCGCCCCTGCTAGCTCAGGG + Intergenic
1083266961 11:61551221-61551243 CACACACCCCCAAAAACTCAGGG - Intronic
1083318548 11:61831138-61831160 CACCCACCCCACGCTGCTCAAGG - Intronic
1083448095 11:62724032-62724054 CACACACCCCTCAAAGAAGAGGG - Intronic
1084047938 11:66581013-66581035 CTCCCACCCCTAAAAGCCCCAGG + Intergenic
1084704879 11:70810359-70810381 CTCCCACCCCTCCCAGCTCTCGG - Intronic
1084888694 11:72225802-72225824 CACTCAGCACTCATAGCTCAGGG - Intronic
1085718771 11:78895560-78895582 CACCCACTCCCCAAAACTCTAGG + Intronic
1086690743 11:89786970-89786992 CACCCGCCCCTACTAGCTCAGGG - Intergenic
1086697780 11:89864535-89864557 CACCCGCCCCTGCTAGCTCAGGG + Intergenic
1086708382 11:89979953-89979975 CACCCGCCCCTGCTAGCTCAGGG - Intergenic
1086715057 11:90052689-90052711 CACCCGCCCCTACTAGCTCAGGG + Intergenic
1086900797 11:92365789-92365811 CTCCTACCCCTCATAGGTCAAGG + Intronic
1087762716 11:102119125-102119147 CCCCCACCCCCCAGAGCTAAGGG - Intronic
1089090849 11:115873541-115873563 CACACACACTTCAAACCTCAAGG - Intergenic
1091345073 11:134846977-134846999 CACCCTCCCCTCTAAGCCCTGGG - Intergenic
1092007974 12:5085639-5085661 CACCCACTCCCCAAATCACAAGG - Intergenic
1092195926 12:6549718-6549740 CACCCACCCCTGAGAGCAGAGGG + Intronic
1096388021 12:51207899-51207921 CACCCACTCCTCACTGCACAGGG - Intronic
1097957487 12:65501140-65501162 AACCCAGCCCTCACACCTCAGGG - Intergenic
1099158713 12:79212348-79212370 CTCCCACCCCTGAAAGGTCCGGG - Intronic
1102744426 12:115237925-115237947 CACACACCCCTAAAACATCAGGG + Intergenic
1103940021 12:124496418-124496440 CACACACCCCCCAGAGCTGAGGG + Intronic
1104042427 12:125139260-125139282 CACTCACCCGCCACAGCTCAGGG + Intronic
1104147559 12:126049835-126049857 CACCCACAGCTCAAACCTTAAGG - Intergenic
1105406112 13:20133926-20133948 CAGCCACCCCTCCAAGCCCAGGG + Intergenic
1112395745 13:99029224-99029246 CACCCACACCTCACAGGTCTGGG + Intronic
1113901517 13:113800757-113800779 CACCCACCCCACCAAGGGCAGGG - Intronic
1113923347 13:113927008-113927030 CAGGTACCCCTCAAAGCTCTCGG - Intergenic
1113944099 13:114033967-114033989 CCCACACCCATCAGAGCTCAGGG + Intronic
1117467044 14:56004082-56004104 CACACACCCCTCAAAACAAAAGG - Intergenic
1118885321 14:69860842-69860864 AGCCCACCTATCAAAGCTCAAGG - Intronic
1120379607 14:83759019-83759041 CACCCACCCCCAAAATCTCTAGG + Intergenic
1121011256 14:90521514-90521536 CACCCAACCCTGCAAGGTCACGG - Intergenic
1121553438 14:94819412-94819434 CACCCATCCCTGCAGGCTCAGGG - Intergenic
1121885651 14:97540386-97540408 GACCCACCTCTCAGAGCTCCAGG + Intergenic
1122689637 14:103526019-103526041 CACCCACCTCAGAAAGCTGAGGG - Intergenic
1122761593 14:104032864-104032886 CAGCCACCCTTGAAAGATCATGG + Intronic
1122940898 14:104980939-104980961 CACCCATCCCGCAAAGCCAAGGG - Intergenic
1123932728 15:25179594-25179616 CACCACCCCCACAAGGCTCAAGG - Intergenic
1124379789 15:29155756-29155778 CACCCACCCCTCAGGGATCAGGG + Intronic
1125512201 15:40298146-40298168 CTCCAACCCCTCAAAGCTTCTGG + Intronic
1125733090 15:41905165-41905187 CACGCGCCCCTCAAAGCTTCCGG + Intronic
1127820315 15:62649090-62649112 CACCCACCTCTCAAAGTGCTAGG + Intronic
1131047546 15:89325768-89325790 CACCCACCCTCCAAAGCCCTGGG + Intronic
1132039223 15:98511312-98511334 CAACCACCACTCTAATCTCACGG + Intronic
1132465074 16:73616-73638 CACCCACCACTCAGAGCTCCTGG - Intronic
1132815498 16:1824404-1824426 CACCCACTCCTCCCAGCTCTTGG - Intronic
1133735537 16:8612134-8612156 CACCCACCCCTTCATGATCATGG + Intergenic
1137610508 16:49814269-49814291 CCCCCACCCCCCAGAGCCCACGG - Intronic
1140030855 16:71338123-71338145 CCCCCACCCCTCAACGCTCCTGG - Intergenic
1141772112 16:86095843-86095865 CACCCAGGCCTCAGAGCTCCTGG + Intergenic
1143627873 17:8121554-8121576 CCACCACCCCCCAAGGCTCAGGG + Exonic
1143833455 17:9670895-9670917 AAACCACCCCTCAGACCTCAAGG - Intronic
1144574516 17:16420448-16420470 CACCCACCCCTCAGGCCTCCTGG + Intronic
1144782568 17:17815371-17815393 CACCCTCCTCTCCAAGCTAAGGG + Intronic
1145940545 17:28741269-28741291 CCCCCACCCCCCACTGCTCATGG - Intronic
1146991395 17:37276155-37276177 CCCCCACCCCTCACATATCAAGG + Intronic
1147382736 17:40065208-40065230 CTCCCTACCCTAAAAGCTCAGGG + Intronic
1149303155 17:55324167-55324189 GACCCATCCCTCAAAGCAGAAGG + Exonic
1149506660 17:57200103-57200125 AACCCACCCTTCAAAGACCAGGG - Intergenic
1151430703 17:74060594-74060616 CTCCCACCTCCCAAGGCTCAGGG + Intergenic
1152561354 17:81080362-81080384 CAGCCGCCGCTCGAAGCTCAGGG + Intronic
1153509907 18:5840181-5840203 CACCCAACCATCTAGGCTCATGG - Intergenic
1154314893 18:13296885-13296907 CAGCCTGCCCTCAAAGCTCACGG - Intronic
1159903186 18:74066911-74066933 CCCCCACCCCTCATGCCTCAGGG - Intergenic
1160961069 19:1721042-1721064 CACCCTCTCCCCAAAGGTCAGGG + Intergenic
1161216032 19:3095422-3095444 CACTCACCCCTCACTGCTCAGGG + Intronic
1161441030 19:4291696-4291718 CAGCCACCCCTGAGAGCTCTGGG + Intergenic
1161458189 19:4380431-4380453 CACCCATCCTTAAAAGCCCACGG - Intronic
1161739643 19:6012926-6012948 CACCCACCCCTCCATGCTCCAGG + Intronic
1162791089 19:13063316-13063338 CACCCACCCCTGAATGCTTCTGG - Intronic
1163088678 19:15002672-15002694 CATCCACCCCTCAAATATGATGG - Intronic
1167151365 19:47712149-47712171 CCCCCAACCCTCCAAGTTCATGG - Intergenic
1167473797 19:49689102-49689124 CACCCACCCTTCCACCCTCAGGG + Exonic
1167566698 19:50261459-50261481 CTCCCACCCCTCACAGATCCAGG + Exonic
1167617395 19:50543008-50543030 GAGCCACCCCCCAGAGCTCACGG + Intronic
1167710772 19:51109115-51109137 CACCCTCCCCACAAGGCCCAAGG + Intergenic
925555374 2:5125422-5125444 CCCACACCCCTCCAAGCTGATGG - Intergenic
925905689 2:8538652-8538674 CTCCCTCCCGTCAAAGGTCACGG + Intergenic
928020630 2:27702003-27702025 GACCCACTCCTCAAAGGTCAAGG - Intergenic
928430629 2:31215562-31215584 CCCTCATCCTTCAAAGCTCAGGG + Intronic
930056533 2:47256701-47256723 TACCAGCCCCTCAAAGCTCTAGG - Intergenic
931984627 2:67729752-67729774 CACCCTCTCCTCTTAGCTCAGGG - Intergenic
932456470 2:71852732-71852754 CTCCCTCCCCTCAAAGCTCAGGG + Intergenic
933799684 2:85950782-85950804 CTCCCACCACTCACAGCTTATGG + Intergenic
934588441 2:95526358-95526380 CACCCGCCCCTGCTAGCTCAGGG - Intergenic
936055084 2:109256531-109256553 CACTAGCCCCTCAAAGCTCCAGG - Intronic
937824904 2:126357821-126357843 CCCCCACCCCTCAAAACTCCTGG + Intergenic
941793033 2:169573785-169573807 CGCCCAACCCTCATATCTCAGGG + Exonic
946789428 2:223285346-223285368 CTCCCATCCCTGAAGGCTCAGGG - Intergenic
947714406 2:232332530-232332552 CACCCAGCCCTGAAAGCTCGGGG + Intronic
948183351 2:236000496-236000518 CACCCCACCATCAACGCTCAGGG - Intronic
948314941 2:237020876-237020898 CACCCACCTCTCAAAGTGCTGGG + Intergenic
948569890 2:238911225-238911247 CACCCAGCCCCCAGTGCTCATGG - Intergenic
1169194551 20:3676165-3676187 CACCCACCCCACCCAGCCCAAGG + Intronic
1171328409 20:24316693-24316715 CACCCAGCAGTCAGAGCTCAGGG - Intergenic
1171361422 20:24588950-24588972 CACCCCCACCCCACAGCTCAGGG - Intronic
1172096376 20:32462484-32462506 CACCCACCCCTCACTGCACCTGG + Intronic
1172117447 20:32581372-32581394 CACACACCCAGAAAAGCTCAGGG + Intronic
1172826147 20:37788145-37788167 CACCCAACCTTCAAAACTTAGGG - Intronic
1173650843 20:44663121-44663143 CACCCACCCTTCAAAGCAAGAGG + Intergenic
1173735178 20:45355876-45355898 CAAACACCCCACAAATCTCAGGG - Intergenic
1174362370 20:50037077-50037099 CCTCCACCCCTCAGATCTCAGGG + Intergenic
1174420157 20:50394186-50394208 CATCCACCTCTCCAAGCACACGG - Intergenic
1174505120 20:51012584-51012606 TTCCCAACCCTCAAAGCTAAGGG + Intronic
1174558719 20:51414789-51414811 CATCCTCCCCTCACAGCTGAGGG + Intronic
1175482276 20:59320211-59320233 CACCCGCCTCTCAGAGGTCACGG + Intronic
1176114286 20:63424354-63424376 CACCCACCCCAGAGAGCCCACGG + Intronic
1176311427 21:5152663-5152685 CACCCACCCTTCACAGCACAGGG + Intronic
1176994748 21:15542473-15542495 CACCCACACCTCAGAGCTCTTGG + Intergenic
1179175542 21:39005348-39005370 CACGCTCCCCTGAAGGCTCAGGG + Intergenic
1179845623 21:44109372-44109394 CACCCACCCTTCACAGCACAGGG - Intronic
1179874178 21:44259259-44259281 CACCCGCCTCCCATAGCTCAGGG + Intronic
1181164699 22:20977016-20977038 CACCCACTCCCCACAGCTGAAGG + Exonic
1181166706 22:20987765-20987787 CACCCAACCCTGTGAGCTCAGGG - Intronic
1181426867 22:22849313-22849335 CCCCCACCCTCCAGAGCTCATGG + Intronic
1181897350 22:26122175-26122197 CTCCCACCCATTAAATCTCATGG - Intergenic
1182237565 22:28888140-28888162 TACCCACCCCTAATAGCTAAAGG - Intronic
951334297 3:21402841-21402863 CCCCCACCTCTCAAAGTTCTGGG - Intergenic
952389056 3:32864435-32864457 CACCCACCCCACACAGCTTGAGG - Intronic
952967927 3:38632500-38632522 TTGCCAGCCCTCAAAGCTCAGGG + Intronic
953434611 3:42868537-42868559 CAACCTCCTCTCAAAGCACAGGG - Intronic
954252989 3:49382808-49382830 CACCCACCTCTCAAAGTACTGGG - Intronic
954369965 3:50165082-50165104 CACCCACCCCACAGGACTCAGGG - Intronic
954716858 3:52531321-52531343 GAGCCACCCCTCAAGGCCCAGGG + Intronic
958881006 3:99669844-99669866 AGCCCACCCCTCAAAGAGCAGGG - Intronic
959286041 3:104412412-104412434 CACCCACCCCTTCAAGATTAAGG - Intergenic
960403034 3:117227182-117227204 CACACACACCTCAAAGATGAAGG - Intergenic
960574799 3:119218903-119218925 CACCCACCTCCCAATGCTCCTGG + Intronic
961041866 3:123683421-123683443 CGCCCACCCCTCAGAGCCCCAGG - Intronic
961447171 3:126986278-126986300 CGCCCCCGCCTCAGAGCTCAAGG - Intergenic
961506265 3:127372334-127372356 CAGGCTCCCCTCAAAGCACATGG + Intergenic
962932873 3:140053718-140053740 CACCAAAGCCTCACAGCTCAGGG - Intronic
963041151 3:141071024-141071046 CCTCCAGCCCTCAAAGCTCTTGG + Intronic
966913897 3:184574553-184574575 CACCTACCCCTCAGAGCTGTAGG - Intronic
967445927 3:189566428-189566450 CACCAAGCCTTCAAATCTCAGGG - Intergenic
968068584 3:195772370-195772392 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068591 3:195772400-195772422 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068612 3:195772490-195772512 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068619 3:195772520-195772542 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068659 3:195772699-195772721 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068693 3:195772849-195772871 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068702 3:195772889-195772911 CACCCTCCCTTCATCGCTCAGGG + Intronic
968068734 3:195773039-195773061 CACCCTCCCTTCATCGCTCAGGG + Intronic
968222748 3:196950384-196950406 CCCCCACCCCTCAGAGCTCTGGG - Intronic
968308805 3:197666450-197666472 CCCACACCCCTACAAGCTCAGGG + Intergenic
968403486 4:318331-318353 GACCCACCCCAGAAAGCTCTGGG - Intergenic
970495187 4:16617885-16617907 CACCCACCCCTAACATCTAAAGG - Intronic
974518306 4:62945128-62945150 CCCCCACCCCTCAAAGGCCCTGG - Intergenic
975281075 4:72563616-72563638 CTTCCACCCCACAAAGCACAGGG - Intronic
976213091 4:82691680-82691702 CACCCACCTCTCTAATCACATGG - Intronic
984851390 4:184156164-184156186 CACCCTCCCATCTCAGCTCAGGG - Intronic
985747443 5:1655205-1655227 CCCACACCCCTACAAGCTCAGGG + Intergenic
985881415 5:2641571-2641593 CACCCACCCAAGACAGCTCAAGG - Intergenic
987090980 5:14507511-14507533 CACCCACCGGGCAAAACTCATGG - Intronic
987869963 5:23603294-23603316 CACACACCGCTGAAAGCTCTGGG + Intergenic
990153522 5:52847797-52847819 CACCCACCTCTCAAAGTGCTGGG + Intronic
996866154 5:128124765-128124787 CTCCCACCCCTCACACCTTAGGG - Intronic
997205860 5:132049674-132049696 CACCCACCCCTGAAGGCCAAGGG - Intergenic
997360846 5:133293840-133293862 CACACAACCCCCAAATCTCAGGG - Intronic
997381988 5:133444829-133444851 CACCCACTCCACTAAGCCCATGG + Intronic
997580144 5:135011963-135011985 CAGCTACCCCCCAAAGCACATGG + Intergenic
998761161 5:145433701-145433723 CATCCTCCCCTCAAAGGTCTAGG + Intergenic
1002373028 5:178769737-178769759 CACCCGCCCGCCACAGCTCAGGG - Intergenic
1003268684 6:4588801-4588823 CACCCAGCCCTCAAAGCTCCAGG + Intergenic
1003925992 6:10878076-10878098 CACCCACACCCCAAAGCTCATGG - Intronic
1005842972 6:29756445-29756467 CCCCCACCCCAGAAAGCTTAAGG + Intergenic
1006250228 6:32777379-32777401 CTCCCACCCCTAAAATATCATGG + Intergenic
1006415892 6:33903726-33903748 CACCCACACCTCAAGGGACAGGG - Intergenic
1006753689 6:36396411-36396433 CCCCTACCCCTGAAGGCTCAGGG + Intronic
1007264464 6:40586496-40586518 CACCCAGTCCACAGAGCTCAGGG + Intronic
1007406984 6:41640824-41640846 CACCCACCCCTGAGAGCCCCGGG + Intronic
1007430987 6:41776921-41776943 CAACCACCCCACCAAGTTCAAGG - Exonic
1010178478 6:73056536-73056558 CTCCTGCCCCTCAAAGGTCAAGG - Intronic
1011087522 6:83559183-83559205 GACCCAGCCCTAAAATCTCATGG - Intronic
1012438496 6:99239920-99239942 CACTCACCTCTCAACGCTAAAGG + Intergenic
1012446908 6:99316091-99316113 TACTGACCCCTTAAAGCTCAGGG - Intronic
1018013022 6:159689001-159689023 CCCCCACCCCCCAAAACTGAGGG - Intronic
1020000931 7:4755159-4755181 CACCCACCCGTCACAGCTGATGG - Intronic
1020368307 7:7404241-7404263 CTCCTACCCCTCAGAGGTCAAGG + Intronic
1022283806 7:28935940-28935962 CACCCTACCCTAAAAGCACATGG + Intergenic
1022450551 7:30509909-30509931 CTCCCACCCCTCAAACATCTAGG + Intronic
1022470718 7:30680527-30680549 GCCCCACCCCACACAGCTCACGG + Intronic
1024322617 7:48086036-48086058 TCCCCACCTCTCAGAGCTCAGGG + Intergenic
1024503250 7:50136242-50136264 CACCCACACCTCTAAGCCAAGGG - Intronic
1025250818 7:57350306-57350328 CATCCACCTCTCCAAGCACACGG + Intergenic
1032341705 7:131079906-131079928 CTCCCAATCCTCAATGCTCAGGG + Intergenic
1033801656 7:144909092-144909114 CAGCCACAGCTCAAAGATCAGGG - Intergenic
1034468999 7:151245787-151245809 CACCCATCGCTCAACGCTCAGGG - Intronic
1034484077 7:151346507-151346529 CACCCTCCCCTCCAACCTCTGGG + Intronic
1035571766 8:677058-677080 CACACCGCCCTCAAAGCCCAGGG + Intronic
1036036535 8:5026308-5026330 CATCCACCCCTCAAACCTCTCGG + Intergenic
1038382544 8:27110130-27110152 CACCAAGCCCTGAAAGTTCAGGG + Intergenic
1038427266 8:27471928-27471950 GCCCCACCCCTCAAACCTCCAGG + Intronic
1043837181 8:85061272-85061294 CACCCACCCCTCACCCCTCCTGG - Intergenic
1046919729 8:119715462-119715484 CAGCCCCCACTCATAGCTCAGGG - Intergenic
1047308018 8:123668960-123668982 CTCCCATCCCTCAATCCTCAGGG - Intergenic
1048847803 8:138616618-138616640 CAACCACCTCACAAGGCTCAGGG + Intronic
1049248585 8:141576157-141576179 CCCCCAGCCCTCAAAGTTCTGGG + Intergenic
1049336285 8:142088353-142088375 CTGCATCCCCTCAAAGCTCAGGG - Intergenic
1049392957 8:142381473-142381495 CCCCCACCCCACCAAGCACAAGG + Intronic
1051825327 9:21212332-21212354 CACCCACCCCTCACATCACCAGG + Intronic
1051827304 9:21234392-21234414 CACCCACCCCTCACATCACCAGG + Intronic
1052852295 9:33385580-33385602 CCCCCACCCCTCAACACACAGGG + Intronic
1053544535 9:39009416-39009438 CACCCACACCTTCAAGCTCCAGG + Intergenic
1053808967 9:41832898-41832920 CACCCACACCTTCAAGCTCCAGG + Intergenic
1054621625 9:67354530-67354552 CACCCACACCTTCAAGCTCCAGG - Intergenic
1057561502 9:96131437-96131459 CACCCACCCCTCCCGGCTCAGGG - Intergenic
1058142616 9:101373793-101373815 CTCCCACCCATCAAAGGTCTCGG + Intronic
1060656243 9:125374515-125374537 CTCCCACCCCACCAAGCACAGGG + Intergenic
1061259380 9:129471422-129471444 CACCCACCCTTCAGGGCTCCTGG - Intergenic
1061953615 9:133950068-133950090 AACCCACTCCTCATGGCTCAGGG - Intronic
1062581103 9:137229610-137229632 CACCCACTCAACAAAGCTCATGG + Exonic
1185646916 X:1622533-1622555 CACCCACCTCCCAAAGCGCAGGG + Intronic
1187257193 X:17654255-17654277 CACCCACCCCTTAAACCTTGGGG + Intronic
1188257591 X:27981374-27981396 AGCCAACCCCTAAAAGCTCAGGG + Intergenic
1190342020 X:49304207-49304229 TCCCCACTCCACAAAGCTCAGGG - Intronic
1190725323 X:53186587-53186609 CACCCACACCTGAAGCCTCATGG + Intergenic
1194557511 X:95379182-95379204 CACACAACCCACAAAACTCAAGG - Intergenic
1195028110 X:100898669-100898691 CACCCACCCATGAAAGCTTAAGG - Intergenic
1197663691 X:129200457-129200479 CATCCAGCCCTCAAAGCTGTAGG - Intergenic
1200148426 X:153939603-153939625 CACCCTCCCCTCCAAGCCCCAGG + Intronic
1200465320 Y:3509134-3509156 GACCCACCCCTCAACCTTCAGGG - Intergenic