ID: 1076021558

View in Genome Browser
Species Human (GRCh38)
Location 10:127077849-127077871
Sequence ACACCCACCCCTCAAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 253}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076021558_1076021560 -10 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021560 10:127077862-127077884 GGGTGGGTGTGAGTTGAGATGGG No data
1076021558_1076021569 17 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG No data
1076021558_1076021574 30 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021574 10:127077902-127077924 GGCAGGAGGGTATGGATGGGAGG No data
1076021558_1076021566 9 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021566 10:127077881-127077903 TGGGGGAGCATTCCATGGAGGGG No data
1076021558_1076021564 7 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021564 10:127077879-127077901 GATGGGGGAGCATTCCATGGAGG No data
1076021558_1076021571 22 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021571 10:127077894-127077916 CATGGAGGGGCAGGAGGGTATGG No data
1076021558_1076021562 -8 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021562 10:127077864-127077886 GTGGGTGTGAGTTGAGATGGGGG No data
1076021558_1076021573 27 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021573 10:127077899-127077921 AGGGGCAGGAGGGTATGGATGGG No data
1076021558_1076021565 8 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021565 10:127077880-127077902 ATGGGGGAGCATTCCATGGAGGG No data
1076021558_1076021561 -9 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021561 10:127077863-127077885 GGTGGGTGTGAGTTGAGATGGGG No data
1076021558_1076021563 4 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021563 10:127077876-127077898 TGAGATGGGGGAGCATTCCATGG No data
1076021558_1076021572 26 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021572 10:127077898-127077920 GAGGGGCAGGAGGGTATGGATGG No data
1076021558_1076021567 13 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021567 10:127077885-127077907 GGAGCATTCCATGGAGGGGCAGG No data
1076021558_1076021568 16 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021568 10:127077888-127077910 GCATTCCATGGAGGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076021558 Original CRISPR ACACCCACCCCTCAAAGCTC AGG (reversed) Intronic
900104436 1:976331-976353 AGACCCAGCCCTCAAAGGGCGGG + Intronic
900593174 1:3468757-3468779 ACAGCCACCCCACAGGGCTCAGG - Intronic
901289936 1:8116179-8116201 ACTCTGACCCCTCAAAGTTCTGG - Intergenic
901447897 1:9319359-9319381 ACACCCAGCCCCCACAGGTCAGG + Intronic
903655640 1:24947518-24947540 ACTCCAACCCCTCAAAGACCGGG - Intronic
903816324 1:26066951-26066973 ACACCCTCCTCCCAAAGCTCTGG + Intronic
905467748 1:38168360-38168382 TCACTCACCTTTCAAAGCTCAGG - Intergenic
905680180 1:39864822-39864844 ACAGCCAGCACTCAGAGCTCTGG - Intronic
909376124 1:74944104-74944126 ACCCCAACCCCCAAAAGCTCTGG - Intergenic
914680574 1:149935765-149935787 ACACCCACCCCTCCAAGAAAGGG + Intronic
914792077 1:150887000-150887022 ACAGCCACCATTAAAAGCTCAGG - Intergenic
914901073 1:151711443-151711465 ACCCCCGCCCCCCAAATCTCTGG + Intronic
916585573 1:166147018-166147040 AGACCCAGAACTCAAAGCTCTGG - Intronic
916706418 1:167355742-167355764 CCTCCCACCTCTCAAATCTCTGG + Intronic
919873737 1:201845263-201845285 ACTCCCACCTCTCAAAGTTCTGG + Intronic
919988436 1:202691981-202692003 ACCCCCAGCCCTCATAGCTCTGG + Intronic
922408363 1:225342843-225342865 ACCCCCACCCCTCACAGCCTGGG + Intronic
924204094 1:241693395-241693417 CCTCCCTCCCCTCAAAGCCCTGG - Intronic
924462505 1:244271952-244271974 ATAGCCACTCCACAAAGCTCCGG - Intergenic
924826454 1:247544587-247544609 CCACCCACCTCTCAAAGTGCTGG - Intronic
1068938185 10:62656472-62656494 ACACCCACCTCTCAAAGTCCTGG - Exonic
1069788443 10:71004546-71004568 TCATCCACCTCTCAAAACTCCGG + Intergenic
1070380818 10:75878829-75878851 CCAGCCACCTCTCAGAGCTCTGG + Intronic
1070692049 10:78534158-78534180 CCACCCATCCTTCAAGGCTCAGG + Intergenic
1072278021 10:93841859-93841881 TCTCCCACCTCTCAAAGCACTGG + Intergenic
1073737157 10:106362084-106362106 CCACCCACCTCTCAAATTTCTGG - Intergenic
1074094072 10:110292696-110292718 ACACCCACCCCTCTCAACCCAGG - Exonic
1074511707 10:114118482-114118504 AAAAGCACCCCTCAAAGCTGGGG - Intergenic
1075760050 10:124848802-124848824 ACCGCCACCTCTCAAAGTTCTGG + Intergenic
1076021558 10:127077849-127077871 ACACCCACCCCTCAAAGCTCAGG - Intronic
1076601980 10:131663216-131663238 ACACCCACTCCTGGAAGCTAGGG + Intergenic
1077043033 11:532950-532972 ACAGCAGCCCCTCAAAGGTCAGG + Intronic
1077157957 11:1099752-1099774 ACACCCACCACTGGAAGCACGGG + Intergenic
1078680137 11:13468038-13468060 ACAGCCAGCCCTCAGAGCTTTGG + Intergenic
1079245654 11:18750460-18750482 ACTCCCACCCCTCAACCATCTGG + Intronic
1079318464 11:19430141-19430163 ACCCCCACCCCTCTCAGTTCTGG + Intronic
1081577704 11:44329659-44329681 ACACCCACCCTTCATTGCTGTGG + Intergenic
1081701695 11:45156493-45156515 ACACCCATCCAGCACAGCTCAGG - Intronic
1081866384 11:46362730-46362752 ACACCCACCCTCCAGAGCCCAGG - Intronic
1082162629 11:48901117-48901139 ACACCCGCCCCTGCCAGCTCAGG + Intergenic
1082175024 11:49049115-49049137 ACACCCGCCCCTGCTAGCTCAGG + Intergenic
1082243353 11:49892710-49892732 ACACCCGCCCCTGCGAGCTCAGG + Intergenic
1082657849 11:55873536-55873558 ACACCCGCCCCTGCTAGCTCAGG + Intergenic
1083448096 11:62724033-62724055 ACACACACCCCTCAAAGAAGAGG - Intronic
1083769219 11:64856999-64857021 ACACCCACACCCCTCAGCTCAGG + Intronic
1086349896 11:85934922-85934944 ACACCCACTCCCCGATGCTCTGG - Intergenic
1086690744 11:89786971-89786993 ACACCCGCCCCTACTAGCTCAGG - Intergenic
1086697779 11:89864534-89864556 ACACCCGCCCCTGCTAGCTCAGG + Intergenic
1086708383 11:89979954-89979976 ACACCCGCCCCTGCTAGCTCAGG - Intergenic
1086715056 11:90052688-90052710 ACACCCGCCCCTACTAGCTCAGG + Intergenic
1086989903 11:93291456-93291478 ACTCCCACTCCTCTAAGCTTTGG + Intergenic
1087170328 11:95043327-95043349 ACACCCACCCCTGGATTCTCTGG - Intergenic
1088795185 11:113261495-113261517 ACACCCACCCCAGCAAGCACTGG - Intronic
1091345074 11:134846978-134847000 ACACCCTCCCCTCTAAGCCCTGG - Intergenic
1094468725 12:30782371-30782393 ACTTCCACCCCTCAAAAGTCCGG - Intergenic
1099158714 12:79212349-79212371 CCTCCCACCCCTGAAAGGTCCGG - Intronic
1102744425 12:115237924-115237946 ACACACACCCCTAAAACATCAGG + Intergenic
1103296540 12:119891951-119891973 ACATCAGCCCCTCAAAGTTCTGG + Intergenic
1104968287 12:132519588-132519610 GCACCCACAGCTCGAAGCTCAGG - Intronic
1105406111 13:20133925-20133947 GCAGCCACCCCTCCAAGCCCAGG + Intergenic
1106027421 13:25968324-25968346 ACCCCCACCCCGCAAAGAACCGG - Intronic
1106690780 13:32113775-32113797 AGACCTGGCCCTCAAAGCTCAGG - Intronic
1107542052 13:41398007-41398029 ACACACACCCCTCAACTCTGAGG - Intergenic
1108054693 13:46473965-46473987 AAACCCACCCCTCAAGGGCCAGG - Intergenic
1109862782 13:68222667-68222689 ACCTCCATCTCTCAAAGCTCTGG + Intergenic
1110408869 13:75182460-75182482 ACACATGCCTCTCAAAGCTCTGG - Intergenic
1111645601 13:91028145-91028167 ACCTCAACCTCTCAAAGCTCTGG - Intergenic
1112083904 13:96007366-96007388 AAAGCCATCCCTCAAAGATCTGG + Intronic
1112395744 13:99029223-99029245 TCACCCACACCTCACAGGTCTGG + Intronic
1113966520 13:114156072-114156094 CCACCCACCCCTCCAAACCCAGG - Intergenic
1116682037 14:47984278-47984300 GCCCCCACCCCTCAAAGCTATGG + Intergenic
1119651259 14:76385228-76385250 ACAACCAAACCTCAAAGCTTTGG + Intronic
1121034858 14:90693503-90693525 ACACCAACCCCTCAACACCCTGG + Intronic
1121436731 14:93925577-93925599 ACACATAGCCCTCAAATCTCTGG + Intronic
1122145500 14:99686506-99686528 TCTCCCACCCCTCACAGCCCTGG + Intronic
1122411903 14:101529842-101529864 CCACCCACACCTCTATGCTCAGG + Intergenic
1122689638 14:103526020-103526042 ACACCCACCTCAGAAAGCTGAGG - Intergenic
1122774633 14:104111761-104111783 ACCCCCACCACTCAGAGCCCCGG - Intronic
1123015384 14:105371298-105371320 ACACCCACCCCTGAACCCACAGG - Intronic
1124379788 15:29155755-29155777 TCACCCACCCCTCAGGGATCAGG + Intronic
1128892794 15:71345639-71345661 ACATTCACCCATCAAAGCTGAGG - Intronic
1129651043 15:77490024-77490046 ACTCCCACCTCTCAAAGTGCTGG - Intergenic
1130143984 15:81258201-81258223 ATACCCATCCCTAAAATCTCAGG + Intronic
1131047545 15:89325767-89325789 CCACCCACCCTCCAAAGCCCTGG + Intronic
1134510960 16:14846517-14846539 GCACCCTCCTCTCAAAGCACTGG - Intronic
1134698603 16:16245008-16245030 GCACCCTCCTCTCAAAGCACTGG - Intronic
1134973232 16:18549665-18549687 GCACCCTCCTCTCAAAGCACTGG + Intronic
1135033005 16:19053930-19053952 ACCTCCACCTCTCAAAGCACTGG + Intronic
1136274543 16:29170732-29170754 ACACGCCATCCTCAAAGCTCAGG - Intergenic
1138449197 16:57083082-57083104 ACACTCTCCCCTCCCAGCTCGGG - Exonic
1139480293 16:67226899-67226921 ACAGCCCCTCCCCAAAGCTCAGG + Intronic
1142078829 16:88136391-88136413 ACACGCCATCCTCAAAGCTCAGG - Intergenic
1142177395 16:88651404-88651426 TCCCCCACCCCCCAAGGCTCTGG - Intergenic
1142603579 17:1069759-1069781 ACACTCACCCCGCAGAGGTCAGG + Intronic
1142603612 17:1069857-1069879 ACACTCACCCCGCAGAGGTCAGG + Intronic
1142603629 17:1069905-1069927 ACACTCACCCCGCAGAGGTCCGG + Intronic
1145773011 17:27506924-27506946 CCTCCCACCCCTCAAATCTCGGG + Intronic
1145933561 17:28702262-28702284 AAAGCCACCCCTCAAAGAGCTGG - Exonic
1146283753 17:31560729-31560751 CCACCAACCCCTGAAACCTCGGG + Intergenic
1147468104 17:40627891-40627913 ACATCCAAACCTCAAGGCTCAGG - Exonic
1147860304 17:43517151-43517173 ATGCCCACCCCTCTAGGCTCAGG + Exonic
1149506661 17:57200104-57200126 AAACCCACCCTTCAAAGACCAGG - Intergenic
1149596480 17:57867491-57867513 TGCCCCACCCCTCAAAGCTCTGG + Intronic
1153913579 18:9725135-9725157 GCACCCACCTCCCAAGGCTCTGG - Intronic
1155021830 18:21903607-21903629 ACCTCCACCTCCCAAAGCTCTGG - Intergenic
1158274204 18:55748675-55748697 ACACAGATCCCTGAAAGCTCTGG - Intergenic
1160034777 18:75290520-75290542 ACCCCCATCCCTGAAAGCCCAGG + Intergenic
1160246952 18:77166651-77166673 ACGCGCCCCCCTCCAAGCTCTGG - Intergenic
1160447746 18:78940513-78940535 TCATACACCCCTCACAGCTCAGG + Intergenic
1160573578 18:79835025-79835047 ACACCCACCCCTCCCAGCCAGGG + Intergenic
1160731478 19:643465-643487 ACACCTACGCCTCACAGCGCTGG + Exonic
1161043719 19:2123515-2123537 CCACCCACCAATCAAAGCCCAGG + Intronic
1161216031 19:3095421-3095443 ACACTCACCCCTCACTGCTCAGG + Intronic
1161441029 19:4291695-4291717 CCAGCCACCCCTGAGAGCTCTGG + Intergenic
1161608430 19:5227932-5227954 ACACGCACCCCCCCAAGCACAGG + Intronic
1161742998 19:6035834-6035856 ACACACCCCCCACCAAGCTCTGG - Intronic
1162636815 19:11975321-11975343 ACCCACACCCCCCAAAGTTCTGG + Intronic
1163050216 19:14677518-14677540 ACCCCCACCCCTCATCTCTCTGG - Intronic
1163350216 19:16772114-16772136 TCCTCGACCCCTCAAAGCTCTGG - Intronic
1163400143 19:17087188-17087210 ACGCCCACCCCTCCAGGCCCTGG - Intronic
1164786430 19:30934762-30934784 GCACACACCCCTCAAAGATGAGG + Intergenic
1166863169 19:45821252-45821274 ACAGCCCCACCTCAGAGCTCTGG - Intronic
1167524456 19:49975054-49975076 ACGCCCTCCTCTCAGAGCTCGGG + Intergenic
1168075434 19:53978715-53978737 CCACCCACCCCTAAAACCCCAGG - Intronic
925224053 2:2167224-2167246 ACACTCACCCCTCAAAACCTGGG - Intronic
926803775 2:16685831-16685853 ACACACACCACACAAATCTCTGG + Intergenic
928603624 2:32924512-32924534 ACACACACCCCTCTACTCTCCGG - Intergenic
929956676 2:46463724-46463746 GCACCCACCCCAGACAGCTCAGG - Intronic
931174033 2:59834959-59834981 TCACCTTCCCCTCAAAGCACAGG + Intergenic
932456469 2:71852731-71852753 GCTCCCTCCCCTCAAAGCTCAGG + Intergenic
932471939 2:71965086-71965108 ACACCCACCCCACACACATCTGG + Intergenic
934588442 2:95526359-95526381 ACACCCGCCCCTGCTAGCTCAGG - Intergenic
937614670 2:123907538-123907560 AACCCCACCCCTAGAAGCTCTGG - Intergenic
938681196 2:133691879-133691901 ATACACACCCATCAAATCTCAGG + Intergenic
938739080 2:134213953-134213975 AGTCCCACCCCTAAAATCTCTGG - Intronic
941020291 2:160400854-160400876 AGGACCACCCCTCAAAACTCAGG + Intronic
946789429 2:223285347-223285369 ACTCCCATCCCTGAAGGCTCAGG - Intergenic
947714405 2:232332529-232332551 ACACCCAGCCCTGAAAGCTCGGG + Intronic
948160834 2:235822745-235822767 ACACTCACCACTCCCAGCTCGGG - Intronic
948183352 2:236000497-236000519 ACACCCCACCATCAACGCTCAGG - Intronic
948308346 2:236966891-236966913 AGCCCCACCCCTCCAAGCACAGG - Intergenic
948314940 2:237020875-237020897 CCACCCACCTCTCAAAGTGCTGG + Intergenic
948383782 2:237568866-237568888 ACACTCACTCCTCACAGTTCTGG + Intergenic
949018792 2:241728796-241728818 ACACCCACGCCACAAAGCCCTGG - Exonic
1168912909 20:1464241-1464263 ACACCCAGGCCTGAACGCTCTGG + Intronic
1171133002 20:22672673-22672695 ATACCCCACCCTCAAAGCCCTGG + Intergenic
1171780456 20:29411815-29411837 CCACCCACCCCACAAGGCCCTGG - Intergenic
1172117446 20:32581371-32581393 ACACACACCCAGAAAAGCTCAGG + Intronic
1172363479 20:34331371-34331393 ACTTCCACCCCTCAAAGGGCTGG - Intergenic
1172644418 20:36461203-36461225 ACCCCCACCCCCCCATGCTCGGG + Intronic
1173735179 20:45355877-45355899 ACAAACACCCCACAAATCTCAGG - Intergenic
1174465925 20:50717359-50717381 ACACCAGCCCCTCAAAGTGCTGG + Intergenic
1174560227 20:51425741-51425763 AGACCCACCCTCCAAAGCTCAGG - Intronic
1174767149 20:53265129-53265151 TCCCCCACCCCTGAACGCTCTGG - Intronic
1176311426 21:5152662-5152684 CCACCCACCCTTCACAGCACAGG + Intronic
1179008083 21:37531810-37531832 ACACCCACCCTTCAGGGCTCAGG + Intergenic
1179845624 21:44109373-44109395 CCACCCACCCTTCACAGCACAGG - Intronic
1179874177 21:44259258-44259280 ACACCCGCCTCCCATAGCTCAGG + Intronic
1180066484 21:45415059-45415081 ACAGGCATCCCTCAGAGCTCAGG - Intronic
1180066561 21:45415440-45415462 ACACCCAGGGCTCAGAGCTCAGG + Intronic
1180632484 22:17239328-17239350 CCTCCCACCCTTCAAATCTCTGG - Intergenic
1181166707 22:20987766-20987788 ACACCCAACCCTGTGAGCTCAGG - Intronic
1185005180 22:48271673-48271695 ATCCCCACCCCTCAAAAGTCTGG - Intergenic
1185100747 22:48839656-48839678 ACAGCTGCCCCTCACAGCTCTGG - Intronic
1185301376 22:50082912-50082934 ACCTCCACCCCTCAAAGTGCTGG + Intronic
950218182 3:11174715-11174737 ACCCCCAGCCTTCAAAGCACTGG - Intronic
951334299 3:21402842-21402864 TCCCCCACCTCTCAAAGTTCTGG - Intergenic
951528060 3:23672324-23672346 ACACCCACACCTCCACGTTCTGG - Intergenic
952949763 3:38513049-38513071 ACCTCCACCCCTCAAAGGGCTGG + Intronic
952967926 3:38632499-38632521 ATTGCCAGCCCTCAAAGCTCAGG + Intronic
954252990 3:49382809-49382831 CCACCCACCTCTCAAAGTACTGG - Intronic
954374867 3:50188856-50188878 ACCCCCTCCCCTCAGAGCTGGGG - Exonic
955718129 3:61852746-61852768 ACACATGGCCCTCAAAGCTCAGG - Intronic
956343116 3:68248702-68248724 CCACCCACCCCGCAAAACTCAGG - Intronic
957084623 3:75668696-75668718 CCACCCACCCCACAAGGCCCTGG + Intergenic
958881007 3:99669845-99669867 AAGCCCACCCCTCAAAGAGCAGG - Intronic
958970472 3:100605519-100605541 ACACCCTCCCCACTCAGCTCCGG + Intergenic
959711720 3:109392405-109392427 ACACACACCCCTCCACGATCTGG - Intergenic
960618354 3:119616274-119616296 ACACCCTCCCCTCAAATGCCTGG - Intronic
961676016 3:128567203-128567225 ACACCCACCCCCCACAGCTCAGG - Intergenic
962316035 3:134360061-134360083 CCACCCACCCCCCCAACCTCAGG + Intronic
964003923 3:151808084-151808106 AGACCAACTCCTCAAAGCCCTGG + Intergenic
968068583 3:195772369-195772391 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068590 3:195772399-195772421 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068611 3:195772489-195772511 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068618 3:195772519-195772541 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068658 3:195772698-195772720 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068692 3:195772848-195772870 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068701 3:195772888-195772910 ACACCCTCCCTTCATCGCTCAGG + Intronic
968068733 3:195773038-195773060 ACACCCTCCCTTCATCGCTCAGG + Intronic
968222750 3:196950385-196950407 GCCCCCACCCCTCAGAGCTCTGG - Intronic
968403487 4:318332-318354 TGACCCACCCCAGAAAGCTCTGG - Intergenic
972427852 4:38951449-38951471 ACACACACCCCTAGAAGATCCGG + Intergenic
972953376 4:44358050-44358072 CCCCCCACCCCCCAAAGCCCAGG + Intronic
975709590 4:77147005-77147027 AGTCCCACCACTCAAATCTCAGG - Intergenic
976867445 4:89747260-89747282 ACACACACCCCCCAAGGCTCTGG + Intronic
978430071 4:108624330-108624352 AAACCCTACCCTCAAAACTCTGG - Intronic
978561121 4:110034500-110034522 TCACCCACCTCCAAAAGCTCAGG - Intergenic
983894785 4:173070575-173070597 ACACCCACCCCTATGAACTCAGG - Intergenic
984851391 4:184156165-184156187 ACACCCTCCCATCTCAGCTCAGG - Intronic
985446349 4:190022877-190022899 CCACCCACCCCACAAGGCCCTGG - Intergenic
986611542 5:9572810-9572832 ACCCTCAACCCTCAAATCTCTGG - Intergenic
986817604 5:11429793-11429815 TCTCGCACCCCTCAAAGCACAGG + Intronic
987869962 5:23603293-23603315 CCACACACCGCTGAAAGCTCTGG + Intergenic
988547312 5:32170867-32170889 AACCCCACCCCTCAACTCTCTGG + Intronic
990153521 5:52847796-52847818 CCACCCACCTCTCAAAGTGCTGG + Intronic
990387136 5:55276728-55276750 TCACCCACCCCTCAAATTTAGGG - Intronic
990982883 5:61617341-61617363 TCACCCACTCCTCTAAGCCCAGG - Intergenic
991474494 5:67004758-67004780 ACAGCCTCCTCTCAAAGGTCCGG - Intronic
997205861 5:132049675-132049697 ACACCCACCCCTGAAGGCCAAGG - Intergenic
997360847 5:133293841-133293863 ACACACAACCCCCAAATCTCAGG - Intronic
999124011 5:149233166-149233188 TCACCCTCCCCACCAAGCTCAGG + Intronic
1001982370 5:176046008-176046030 ACACCCACCCCTCACGGTTCAGG - Intergenic
1002235091 5:177798049-177798071 ACACCCACCCCTCACGGTTCAGG + Intergenic
1002312667 5:178324105-178324127 ACCCACACCCCTCACAGCACAGG - Intronic
1002987681 6:2206688-2206710 GGCCCCACCCCTCAGAGCTCTGG + Intronic
1003358714 6:5402382-5402404 CCACCCACCCCCCAAAACTAAGG - Intronic
1003630002 6:7778185-7778207 ACACCCTCCTCTCAAAGCAGTGG + Intronic
1004620227 6:17325036-17325058 AGACCAACTCCTCAAAGCCCTGG - Intergenic
1005310539 6:24554995-24555017 ACCCCTACCCCTGAAAGTTCTGG + Intronic
1006415893 6:33903727-33903749 ACACCCACACCTCAAGGGACAGG - Intergenic
1006513235 6:34532815-34532837 ACATCCATCCCTCAGGGCTCAGG - Exonic
1006753687 6:36396410-36396432 ACCCCTACCCCTGAAGGCTCAGG + Intronic
1007257041 6:40536714-40536736 AGCCCTGCCCCTCAAAGCTCAGG + Intronic
1007406983 6:41640823-41640845 CCACCCACCCCTGAGAGCCCCGG + Intronic
1009418462 6:63440715-63440737 ACCCCCACCCATCAAAACCCTGG + Intergenic
1011704862 6:89990635-89990657 CCACCGACCCCTCCAACCTCTGG + Intronic
1012131545 6:95499776-95499798 ACCCCCACCCCACAAAGCCTCGG + Intergenic
1016601249 6:145863620-145863642 ACACTCTCCCCTAAAAACTCTGG - Intergenic
1016622406 6:146127498-146127520 CCTCCCACCCATCAAACCTCAGG - Intronic
1018013024 6:159689002-159689024 ACCCCCACCCCCCAAAACTGAGG - Intronic
1019532737 7:1511746-1511768 GGGCCCACCCCTCAAACCTCCGG + Intergenic
1019778286 7:2925236-2925258 ACACCCACTGCCCAGAGCTCTGG + Intronic
1019801564 7:3091804-3091826 GCACCCACCCCTCCACCCTCCGG + Intergenic
1022960066 7:35417971-35417993 ACACCCACCACCCACAGTTCAGG + Intergenic
1024010086 7:45259715-45259737 ACACCCACCCTTCCAGGCTGCGG + Intergenic
1024020545 7:45364125-45364147 ACATGCACCCCTCAAAGGTCTGG - Intergenic
1024461349 7:49662840-49662862 ACCCCCACCCCACAACACTCCGG + Intergenic
1024569250 7:50710322-50710344 CCACCCACCTTTCAAAGCCCAGG + Intronic
1027152901 7:75745487-75745509 AAACCCACCCCTAAAGGCTGAGG + Intergenic
1028979566 7:96952630-96952652 ACACCCACTGCACAAATCTCTGG - Intergenic
1031397891 7:121294407-121294429 ACACCTACCCCCAAAAGTTCAGG + Intronic
1032257863 7:130311449-130311471 ACAGCCAGCCCTTAAACCTCAGG + Intronic
1034264497 7:149774291-149774313 GCGCCCACTCCTGAAAGCTCCGG + Intergenic
1034276542 7:149826337-149826359 ACACCTACCCCCCACAGCTGGGG - Intergenic
1034288741 7:149910203-149910225 CCCCCCACCCCGCAAAGTTCAGG - Intergenic
1034446563 7:151116837-151116859 ACACTCACCACTTTAAGCTCCGG - Exonic
1034469000 7:151245788-151245810 CCACCCATCGCTCAACGCTCAGG - Intronic
1034484076 7:151346506-151346528 CCACCCTCCCCTCCAACCTCTGG + Intronic
1034662336 7:152782664-152782686 CCCCCCACCCCGCAAAGTTCAGG + Intronic
1035082240 7:156226339-156226361 TCAACTACCCTTCAAAGCTCTGG + Intergenic
1035572041 8:679128-679150 GCTCTCACCCGTCAAAGCTCCGG + Intronic
1036661932 8:10714563-10714585 TCACCCGCCCCTCCATGCTCGGG + Intergenic
1044570566 8:93713280-93713302 ACCTCCACCTCCCAAAGCTCTGG + Intronic
1046507943 8:115160149-115160171 ACAGCCACCACCCAAAGCTAGGG - Intergenic
1048052715 8:130833873-130833895 ACACACACACCTCAAGTCTCTGG - Intronic
1048847802 8:138616617-138616639 ACAACCACCTCACAAGGCTCAGG + Intronic
1049248583 8:141576156-141576178 TCCCCCAGCCCTCAAAGTTCTGG + Intergenic
1049440829 8:142608855-142608877 CCACCCACCCCTCCAGCCTCCGG + Intergenic
1049459175 8:142715096-142715118 ACCTCAGCCCCTCAAAGCTCTGG - Intergenic
1057561503 9:96131438-96131460 ACACCCACCCCTCCCGGCTCAGG - Intergenic
1058938114 9:109787983-109788005 ACACCAAACTCACAAAGCTCTGG - Intronic
1061908715 9:133711821-133711843 ACAGCCACCCCACAACGCACGGG + Intronic
1185646915 X:1622532-1622554 CCACCCACCTCCCAAAGCGCAGG + Intronic
1187257192 X:17654254-17654276 CCACCCACCCCTTAAACCTTGGG + Intronic
1188257590 X:27981373-27981395 AAGCCAACCCCTAAAAGCTCAGG + Intergenic
1190740065 X:53282724-53282746 CTGCCCACCCCTCAAAGCCCTGG + Intronic
1192129372 X:68533990-68534012 ACACGAACCCCCCAAAGCTGTGG - Exonic
1194856682 X:98939081-98939103 ACACACACCCCTTTAGGCTCAGG + Intergenic
1195169257 X:102249894-102249916 ACACACACCCCTTATAGCCCTGG + Intergenic
1195189600 X:102437194-102437216 ACACACACCCCTTATAGCCCTGG - Intronic
1195325423 X:103754500-103754522 TAACCCAGCCCCCAAAGCTCTGG + Intergenic
1195548329 X:106138518-106138540 CCACCCACCCTTCAGAGTTCAGG - Intergenic
1199842659 X:151665833-151665855 ACACACACCCCTCTAAACTCAGG - Intronic
1200465321 Y:3509135-3509157 AGACCCACCCCTCAACCTTCAGG - Intergenic
1200696310 Y:6364057-6364079 ACACCCACCTCTGGAATCTCAGG - Intergenic
1201037804 Y:9800643-9800665 ACACCCACCTCTGGAATCTCAGG + Intergenic