ID: 1076021569 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:127077889-127077911 |
| Sequence | CATTCCATGGAGGGGCAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076021558_1076021569 | 17 | Left | 1076021558 | 10:127077849-127077871 | CCTGAGCTTTGAGGGGTGGGTGT | 0: 1 1: 0 2: 2 3: 21 4: 253 |
||
| Right | 1076021569 | 10:127077889-127077911 | CATTCCATGGAGGGGCAGGAGGG | No data | ||||
| 1076021557_1076021569 | 18 | Left | 1076021557 | 10:127077848-127077870 | CCCTGAGCTTTGAGGGGTGGGTG | 0: 1 1: 0 2: 3 3: 22 4: 243 |
||
| Right | 1076021569 | 10:127077889-127077911 | CATTCCATGGAGGGGCAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076021569 | Original CRISPR | CATTCCATGGAGGGGCAGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||