ID: 1076021569

View in Genome Browser
Species Human (GRCh38)
Location 10:127077889-127077911
Sequence CATTCCATGGAGGGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076021558_1076021569 17 Left 1076021558 10:127077849-127077871 CCTGAGCTTTGAGGGGTGGGTGT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG No data
1076021557_1076021569 18 Left 1076021557 10:127077848-127077870 CCCTGAGCTTTGAGGGGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1076021569 10:127077889-127077911 CATTCCATGGAGGGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076021569 Original CRISPR CATTCCATGGAGGGGCAGGA GGG Intronic
No off target data available for this crispr