ID: 1076022705

View in Genome Browser
Species Human (GRCh38)
Location 10:127087461-127087483
Sequence CCCAATATTCTCCCCAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076022705_1076022716 24 Left 1076022705 10:127087461-127087483 CCTATCTTGGGGAGAATATTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1076022716 10:127087508-127087530 TAGGGTAGATTGTGGTCCTGCGG No data
1076022705_1076022714 16 Left 1076022705 10:127087461-127087483 CCTATCTTGGGGAGAATATTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1076022714 10:127087500-127087522 GGAGCCTTTAGGGTAGATTGTGG No data
1076022705_1076022708 -5 Left 1076022705 10:127087461-127087483 CCTATCTTGGGGAGAATATTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1076022708 10:127087479-127087501 TTGGGTAGAGTGTTGGTCCCCGG No data
1076022705_1076022717 25 Left 1076022705 10:127087461-127087483 CCTATCTTGGGGAGAATATTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1076022717 10:127087509-127087531 AGGGTAGATTGTGGTCCTGCGGG No data
1076022705_1076022709 5 Left 1076022705 10:127087461-127087483 CCTATCTTGGGGAGAATATTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1076022709 10:127087489-127087511 TGTTGGTCCCCGGAGCCTTTAGG No data
1076022705_1076022710 6 Left 1076022705 10:127087461-127087483 CCTATCTTGGGGAGAATATTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1076022710 10:127087490-127087512 GTTGGTCCCCGGAGCCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076022705 Original CRISPR CCCAATATTCTCCCCAAGAT AGG (reversed) Intronic
900791632 1:4684587-4684609 CCCAAGATTCTACCCAGGAAAGG - Intronic
904433229 1:30478617-30478639 CCCAAGACTCTCCCCATAATTGG - Intergenic
907797481 1:57732111-57732133 ACCACTGTTCTTCCCAAGATTGG - Intronic
908300319 1:62756122-62756144 CCCAATATTCTCTCTCTGATAGG + Intergenic
909359503 1:74744346-74744368 CCCAATATTCTCTCTCTGATGGG - Intronic
910397592 1:86807830-86807852 CCCAATATTCTCTCTTTGATGGG - Intergenic
911112858 1:94210211-94210233 CCTAATATTCTCACCAATAAAGG + Intronic
911370864 1:96993403-96993425 CCCCATTTTCTCCCCAAAAAGGG + Intergenic
913382530 1:118227396-118227418 CCCAATATTCTCTCTCTGATGGG + Intergenic
913469418 1:119174160-119174182 CCCAATATTCTCCTTCTGATGGG + Intergenic
915260471 1:154673350-154673372 CCCAATATTCTCTCTCTGATGGG + Intergenic
916241762 1:162647404-162647426 CCCAATCTACACCCCAAGAGAGG + Intronic
917057238 1:170996405-170996427 ACCTATATTCTGCCCAAGATGGG + Intronic
917086039 1:171306713-171306735 CCCAATATTCTCTCCCTGATGGG + Intergenic
917279793 1:173369711-173369733 CCCAATATTCTTCCTCTGATGGG + Intergenic
917281057 1:173378557-173378579 CCCAATATTCTCTCTCTGATGGG + Intergenic
917676184 1:177321478-177321500 CCCAATATTCTCTCTCTGATGGG + Intergenic
918750264 1:188261867-188261889 CCCAATATTCTCTCTCTGATGGG - Intergenic
919206198 1:194423858-194423880 CCCAATATTCTCTCTCTGATGGG + Intergenic
919558567 1:199092120-199092142 CCCAATATTCTCTCTCTGATGGG + Intergenic
921019606 1:211224042-211224064 CCCAATATTCTCTCTCTGATGGG + Intergenic
922058876 1:222068519-222068541 CCCAATATTCTCAACAATACTGG - Intergenic
923614757 1:235527658-235527680 CACAAAATTCTCCACAAGGTAGG - Intergenic
1063321796 10:5058376-5058398 CCCAATATTCTCTCTTTGATGGG - Intronic
1063414704 10:5864031-5864053 CCCAATATTCTCTCTCTGATGGG + Intronic
1064603658 10:17016984-17017006 CCCAATATTCTCTCTCTGATGGG - Intronic
1064797111 10:19024858-19024880 CCCTCTATTCTCCCAAAGATTGG - Intergenic
1065082319 10:22140657-22140679 CCCAATATTCTCTCTCTGATGGG + Intergenic
1068500221 10:57834541-57834563 CCCAATATTCTCTCTCTGATGGG + Intergenic
1069137422 10:64782958-64782980 CCCAATATTCTCCCTCTGATGGG - Intergenic
1069365172 10:67688573-67688595 CCCAATATTCTCTCTCTGATGGG - Intronic
1071753460 10:88508736-88508758 CCCAATATTCTACTCCAGTTAGG + Intronic
1071834772 10:89408225-89408247 CCCAATATTCTCTCTCTGATGGG + Intronic
1074612950 10:115038905-115038927 CCCAATATTCTCTCTCTGATGGG + Intergenic
1075120207 10:119659224-119659246 CCCCATCCTCTGCCCAAGATAGG + Intronic
1075146250 10:119885375-119885397 CCCAATATTCTCTCTCTGATGGG + Intronic
1076022705 10:127087461-127087483 CCCAATATTCTCCCCAAGATAGG - Intronic
1076498337 10:130914201-130914223 CTCAATACTCTCCCCAAGTCAGG + Intergenic
1078007833 11:7545892-7545914 CCCACTCTCCTCCCCAAGGTAGG - Intronic
1079776860 11:24542547-24542569 CCCAATACACTCCTCATGATAGG - Intronic
1079811743 11:25005450-25005472 CCCAATATTCTCTCTCTGATGGG - Intronic
1080314233 11:30931195-30931217 GCCAATATTTTCTCCAACATTGG - Intronic
1081421338 11:42876825-42876847 CCCAATATTCTCTCTCTGATGGG + Intergenic
1087231395 11:95669878-95669900 CCCCACATCCTCCCCAACATTGG + Intergenic
1087319181 11:96638243-96638265 CCCAATATTCTCTCTCTGATGGG + Intergenic
1087683414 11:101238816-101238838 CCCAATATTCTCTCTCTGATGGG - Intergenic
1088492464 11:110401235-110401257 CCCAATATTCTCTCTCTGATGGG + Intergenic
1089202662 11:116733718-116733740 GCCAAGATTCTCCCCAGGCTGGG + Intergenic
1091514945 12:1169595-1169617 CCCTGTATTCTACCCAAGACTGG - Intronic
1092829149 12:12427120-12427142 CACAAAATTCTCTCCAAGTTGGG + Intronic
1093580645 12:20781439-20781461 CCCAATATTCTCTCTCTGATAGG - Intergenic
1093888439 12:24490329-24490351 CCCAAGATTGTTCTCAAGATGGG + Intergenic
1094338185 12:29383906-29383928 CCCAATATTCTCTCTCTGATGGG - Intergenic
1094414230 12:30201193-30201215 CCCATCGTTCTCCCCAAAATGGG - Intergenic
1095198203 12:39349149-39349171 CCCATTTTTCCCCCAAAGATTGG + Intronic
1098551568 12:71767767-71767789 ACCGATCTTCTCCCCAAAATTGG - Intronic
1099376178 12:81898280-81898302 CCCAATATTCTCTCTCTGATGGG + Intergenic
1099414816 12:82372609-82372631 CCCAATATTCTCTCTCTGATGGG - Intronic
1100092075 12:90984498-90984520 CCCAATATTCTCTCTGTGATGGG + Intronic
1100209711 12:92388438-92388460 CCCAATATTCTCTCTCTGATGGG + Intergenic
1102676653 12:114664080-114664102 CCCAATAATCTCTCCATGAAGGG + Intergenic
1102719790 12:115006156-115006178 CCTTATATTATCCCCCAGATTGG - Intergenic
1103098838 12:118154853-118154875 CACAGGATTCCCCCCAAGATGGG + Intronic
1103160057 12:118721276-118721298 CCCAATATTTTCACCCAGAATGG - Intergenic
1106162613 13:27214567-27214589 CCCAATATTCTCTCTCTGATGGG + Intergenic
1107277694 13:38695367-38695389 CCCAATTTTCCCTCCAAGTTAGG - Intronic
1111229889 13:85330935-85330957 CCCAAAATTATCCCCAGGTTTGG + Intergenic
1111348399 13:86994391-86994413 CCCAATATACCCCTCAACATTGG + Intergenic
1112305217 13:98267490-98267512 CCCCATATCCTTCCCAAGGTTGG + Intronic
1113497206 13:110740663-110740685 ACCTATATTCCCCCCAACATGGG - Intergenic
1114469599 14:22950586-22950608 CCCCATGTTCTCACCAACATGGG - Intronic
1119959535 14:78838980-78839002 CCCACTATTCTCCCTGAGACAGG - Intronic
1120121931 14:80691386-80691408 CACAATCTTCTCCCCACTATTGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1123114975 14:105890488-105890510 CCCCAGGTCCTCCCCAAGATAGG - Intergenic
1123119244 14:105909246-105909268 CCCCATGTCTTCCCCAAGATAGG - Intergenic
1123939086 15:25208162-25208184 TCCAAAATTCTCCCCTAGGTTGG - Intergenic
1123945320 15:25236165-25236187 TCCAAAATTCTCCCCTAGGTTGG - Intergenic
1124414187 15:29461379-29461401 CCCAATATTTTGCTCAAGAAAGG + Intronic
1124794519 15:32764014-32764036 CTAAATATTCTCCCCCAGATCGG - Intergenic
1126072147 15:44874568-44874590 CCCAATATTCTCTCTCTGATAGG - Intergenic
1127178629 15:56389909-56389931 CCCAAGATGCTCCCTAGGATAGG + Intronic
1129247430 15:74287991-74288013 GCCAATATTGTCCCCAAGGCAGG - Intronic
1129693911 15:77729803-77729825 CCAACTATTCAGCCCAAGATTGG + Intronic
1131718401 15:95139479-95139501 CCCAAGATACTGCCCAAGACTGG + Intergenic
1135339756 16:21635615-21635637 CCCAATATTCTCTCTCTGATGGG - Intronic
1136514120 16:30757451-30757473 CCCAACATTTTCCCCAATAAAGG - Exonic
1140773333 16:78226644-78226666 CCTATTATTCTCCACAAGAATGG - Intronic
1148113695 17:45162263-45162285 CCCAACCTTCTCCCCAAGCTGGG - Intronic
1148194686 17:45704831-45704853 CCCTACATTCTCCCCAAGTTTGG - Intergenic
1152089256 17:78237868-78237890 CCCACTCTTCTTCCCAAGTTTGG + Intronic
1153437972 18:5087295-5087317 CCCAATATTCTCTCTCTGATGGG + Intergenic
1153858996 18:9179904-9179926 CACAGAATACTCCCCAAGATAGG - Intronic
1154107133 18:11533160-11533182 CCCAATCCGCTCCCCACGATGGG - Intergenic
1155165765 18:23231123-23231145 CCCAGTTTTCTTCCCAAGAGTGG - Intronic
1156721250 18:40072687-40072709 CCCAGTAGACTCACCAAGATAGG - Intergenic
1156782528 18:40868023-40868045 CCTAATATTCTCCCCAAATAGGG + Intergenic
1157857983 18:51118651-51118673 CCCAATATTCTCTCTCTGATGGG - Intergenic
1159495905 18:69204471-69204493 GCCAATCTTCTCCACAAGACAGG - Intergenic
1161598313 19:5164083-5164105 CCCAATATTCTCTCTCTGATGGG - Intronic
1162107838 19:8381310-8381332 CCCAATATTCTCTCTCTGATGGG + Intronic
927252463 2:21009149-21009171 AGCAATATTCTATCCAAGATTGG - Exonic
928617715 2:33056145-33056167 CCCAATATTCTCTCTCTGATGGG - Intronic
929249156 2:39733643-39733665 GCCAATATTTTCACTAAGATTGG + Intergenic
929330288 2:40674000-40674022 CCCAATATTCTCTCTCTGATGGG + Intergenic
931540394 2:63324085-63324107 CCCAATATTCTCTCTCTGATGGG + Intronic
932322949 2:70835275-70835297 CCCAATAATCTCCCAGAAATTGG + Intronic
933342066 2:81037107-81037129 CCCAATATTCTCTCTCTGATGGG + Intergenic
933348200 2:81117744-81117766 CCCAAGATTATGCTCAAGATTGG - Intergenic
933838914 2:86269884-86269906 CTCAATTTTCTCCCACAGATTGG + Intronic
934134930 2:88986240-88986262 CCCTAAATTCTCACCAAGACTGG + Intergenic
934136805 2:89003526-89003548 CCCTAAATTCTCACCAAGACTGG + Intergenic
934235379 2:90227512-90227534 CCCTAAATTCTCACCAAGACTGG - Intergenic
934867032 2:97822939-97822961 CCCAATATTCTCTCTCTGATGGG + Intronic
935281558 2:101522223-101522245 CCCTATATTCTCCCCAGTCTAGG - Intergenic
935935741 2:108181360-108181382 CCAAATATTCACCCTAAGTTAGG - Intergenic
937462473 2:122101422-122101444 CCCCATATTGTCCCCAGGAATGG - Intergenic
939064958 2:137471693-137471715 CCCAAAGTTCTCCCCAAAATGGG - Intronic
939932498 2:148253035-148253057 CCCAATAATCTCCTCATAATAGG - Intronic
943103159 2:183511104-183511126 CCCAATATTCTCTCTCTGATGGG - Intergenic
944697880 2:202219177-202219199 CCCTATATTCTCCCAAACATGGG - Intronic
1169073615 20:2748992-2749014 CCCAGTTTTCTCCCCAGAATAGG + Intronic
1173047728 20:39528551-39528573 CCCCATATGCTCCCCGAGCTGGG - Intergenic
1175411968 20:58776394-58776416 CCCAATGTTGACCCCAAGATGGG + Intergenic
1177134971 21:17298629-17298651 TCCAATATTCTCTCCCTGATGGG + Intergenic
1178173401 21:30068627-30068649 CCCAATAACATCCCCAGGATTGG + Intergenic
1179296043 21:40063906-40063928 CCCAATGGTAACCCCAAGATGGG + Intronic
949449063 3:4165680-4165702 CCCAATATTCTCTCTCTGATGGG - Intronic
950909330 3:16571997-16572019 CCCAATATTCTCTTAAAGTTAGG - Intergenic
952452930 3:33448484-33448506 CCCAATATTCTCTCTCTGATGGG + Intergenic
952941044 3:38444610-38444632 CCCAATATTCTCTCTCTGATGGG - Intergenic
953208316 3:40851703-40851725 CCCATTATTCTCCCAAGGAAAGG - Intergenic
953361382 3:42300337-42300359 TCCAATTTTCTCCCCAAAAGAGG - Intergenic
954552875 3:51496817-51496839 GACAATATTGTCCCCATGATGGG + Intronic
954586888 3:51744161-51744183 CCCAATATTCTCTCTCTGATGGG + Intergenic
954895374 3:53970752-53970774 CCTAATCTTCTCCCTAAAATGGG - Intergenic
956623762 3:71247115-71247137 CACAATACTTTCCCCAATATTGG - Intronic
956843058 3:73157661-73157683 CCCAATATTCTCTCTCTGATGGG - Intergenic
957448190 3:80341222-80341244 CCCAGGATACTCCCCAATATTGG - Intergenic
958549312 3:95593643-95593665 CCCAATATTCTCTCTCTGATGGG - Intergenic
958601295 3:96299627-96299649 CCCAATATTCTCTCTCTGATGGG + Intergenic
958642992 3:96832625-96832647 CACAATATTGTGCCCAATATTGG + Intronic
960063593 3:113348367-113348389 CCCAATATTCTCTCTCTGATGGG + Intronic
960150095 3:114240579-114240601 AGCAAGAGTCTCCCCAAGATGGG + Intergenic
961261568 3:125606206-125606228 CCCAATATTCTCTCTCTGATGGG + Intergenic
963696646 3:148572685-148572707 CCCAATATTCTCTCTCTGATGGG + Intergenic
965875157 3:173308325-173308347 CAAAATATACTCCCTAAGATAGG + Intergenic
967305954 3:188059805-188059827 ACCAAAATTCTCCTGAAGATAGG - Intergenic
971281306 4:25244528-25244550 CCCAATATTCTCTCTCTGATGGG - Intronic
971486278 4:27163821-27163843 CCTAATTATCTCCCAAAGATAGG + Intergenic
972107115 4:35502959-35502981 GCCAATATTTTCCCCAAAATTGG + Intergenic
972133400 4:35863348-35863370 CCCAATATTCTCTCTCTGATGGG - Intergenic
973045769 4:45533301-45533323 CCCAATATTCTCTCTCTGATGGG + Intergenic
975047894 4:69826686-69826708 CCCAATATTCTCTCTCTGATGGG + Intronic
975595946 4:76048333-76048355 CCCAATATTCTCTCTCTGATGGG - Intronic
977181888 4:93885083-93885105 CCCAATATTCTCCCTTTGCTTGG - Intergenic
977349044 4:95857187-95857209 CCAAATATTCCCCCAAAAATTGG + Intergenic
977835020 4:101636421-101636443 CCCAATATTCTCTCTCTGATGGG - Intronic
978747075 4:112207302-112207324 CCCAATATTCTCTCTCTGATGGG + Intergenic
978844392 4:113254731-113254753 CCCAATATTCTCAACAAGGAAGG - Intronic
980290996 4:130847364-130847386 CCCAATATTCTCTCTCTGATGGG - Intergenic
981570819 4:146148747-146148769 CCCAAAGTTGTCCCCAAGACAGG - Intergenic
983338451 4:166425859-166425881 CCCACAATTCCCCCCAAAATTGG + Intergenic
983835028 4:172375321-172375343 CCCAATATTCTCTCTCTGATGGG - Intronic
984881655 4:184414677-184414699 ACAAATAGTCTCCCCAAGACTGG - Intronic
985143301 4:186865265-186865287 CCCAAATTTCTTCCCAAGACAGG + Intergenic
987929795 5:24389032-24389054 CCCAATATTCTCTCTCTGATGGG + Intergenic
988357712 5:30199476-30199498 CCCAATATTCTCTCTCTGATAGG + Intergenic
988491632 5:31710061-31710083 CCAAATCTCCTCCCCAACATAGG - Intronic
988605598 5:32676132-32676154 CCCAATATTCTCTCTCTGATGGG - Intergenic
989957243 5:50372190-50372212 CCCAATATTCTCTTTATGATGGG + Intergenic
992049263 5:72928163-72928185 CCCAATATTCTCTCTCTGATGGG + Intergenic
992455094 5:76909349-76909371 CCCAATATTCTCTCTCTGATGGG + Intronic
996680275 5:126223152-126223174 CCCAATATTCTCTCTCTGATGGG + Intergenic
997624254 5:135320830-135320852 CCCAATGTCCTCCCCTTGATGGG + Intronic
998914957 5:147002999-147003021 CCCAATATTCTCTCTCTGATGGG + Intronic
1004812132 6:19273080-19273102 CCCAATATTCTCTCTCTGATGGG + Intergenic
1007029915 6:38618261-38618283 CCCAATATTCTCTCCCTGATGGG + Intronic
1008587108 6:52960194-52960216 CCCAATATTCTCTCTCTGATGGG - Intergenic
1009470693 6:64026480-64026502 CCCAATATTCTCTCTCTGATGGG + Intronic
1009872669 6:69469992-69470014 CCCAATATTCTCTCTCTGATGGG + Intergenic
1010074837 6:71787417-71787439 CCCAATATTCTCTCTCTGATAGG + Intergenic
1010269723 6:73905736-73905758 CCCAATATTCTCTCTCTGATGGG + Intergenic
1011375158 6:86679533-86679555 CCCAATATTCTCTCTCTGATGGG - Intergenic
1013977305 6:116092947-116092969 CCCAATATTCTCTCTCTGATAGG + Intergenic
1015836030 6:137421072-137421094 CCCAATTGTCTCCCCAGGACAGG - Intergenic
1021356687 7:19659173-19659195 CCCAATATTCTCTCTCTGATGGG - Intergenic
1023078064 7:36502905-36502927 CCCAATATTCTCTCTCTGATGGG - Intergenic
1024278239 7:47696731-47696753 ACCAACATTCTCCCCAAAAAAGG - Intronic
1024735170 7:52296671-52296693 CCCAATATTCTCTCTCTGATGGG + Intergenic
1027791008 7:82638944-82638966 CCCAATATTCTCTCTCTGATGGG + Intergenic
1028001183 7:85500411-85500433 CCAAATATTCACCCCCAGAAAGG - Intergenic
1032461639 7:132115751-132115773 CCCAATCCACACCCCAAGATAGG - Intergenic
1034086548 7:148327715-148327737 CAAAATATTCTACCCAAGTTAGG - Intronic
1038638670 8:29306833-29306855 CCCAATATTCTCTCTCTGATGGG + Intergenic
1039275889 8:35933861-35933883 CCCAATATTCTCTCTCTGATGGG + Intergenic
1040667988 8:49655150-49655172 CCCAATATTCTCTCTCTGATGGG - Intergenic
1040796916 8:51297422-51297444 CCCAATATTCTCTCTCTGATGGG - Intergenic
1040834907 8:51721698-51721720 ATCAAAATTCTCCACAAGATCGG + Intronic
1040953265 8:52956495-52956517 CCCAATATTCTCTCTCTGATGGG + Intergenic
1040965173 8:53075242-53075264 CCCAATATTCTCTCTCTGATGGG - Intergenic
1042573658 8:70194411-70194433 CCCAACATACTTCCCAAAATGGG + Intronic
1043508286 8:80924304-80924326 GCCAATATTCTGGCCATGATAGG + Intergenic
1044456742 8:92399037-92399059 CCCAATATTCTCTCTCTGATGGG - Intergenic
1044487622 8:92770969-92770991 CCCACCATTCTCCCCATGGTAGG + Intergenic
1047946129 8:129882661-129882683 TCCAAAATTTTCCCCAAGGTTGG - Intronic
1052057896 9:23924018-23924040 CCCAATATTCTCTCCCTGATGGG - Intergenic
1055234293 9:74101280-74101302 TCCATTATTCTTCTCAAGATAGG - Intergenic
1055458400 9:76493891-76493913 CCCAATATTCTCTCTCTGATGGG - Intronic
1056392910 9:86155421-86155443 CCCAATATTCTCTCTCTGATGGG - Intergenic
1056747581 9:89318041-89318063 CCCTAAAATTTCCCCAAGATTGG - Intergenic
1187255035 X:17634899-17634921 CCCATTCTTCTCACCAGGATGGG - Intronic
1188136401 X:26499322-26499344 CCCAATATTCTCTCTCTGATGGG + Intergenic
1188551699 X:31371798-31371820 CTCAACATTGTCACCAAGATCGG - Intronic
1190541333 X:51481480-51481502 CCCAATATTCTCTCTCTGATGGG + Intergenic
1191206058 X:57835151-57835173 CCCAATATTCTCTCTCTGATGGG - Intergenic
1192482889 X:71500340-71500362 CCCAATATTCTCTCTCTGATGGG - Intronic
1194382320 X:93209894-93209916 CCCAATATTCTCCTCAACAGTGG - Intergenic
1195439447 X:104884606-104884628 CCCAATATTCTCTCTCTGATGGG + Intronic
1196047779 X:111274357-111274379 CCCAATATTTTCCCCTATATTGG + Intergenic
1196419512 X:115507773-115507795 CCCAATATTCTCTCTCTGATGGG - Intergenic
1197513285 X:127396875-127396897 CCCAATATTCTCTCTCTGATGGG + Intergenic
1199832536 X:151560362-151560384 CCCAATATTCTCTCTCTGATGGG - Intergenic
1200801137 Y:7388013-7388035 CCCAATATTCTCTCTCTGATGGG - Intergenic
1200880918 Y:8210535-8210557 CCCAATATTCTCTCTCTGATGGG - Intergenic
1200966659 Y:9045173-9045195 CCCAATATTCTCTCTCTGATGGG + Intergenic
1201272038 Y:12264847-12264869 CCCAATATTCTCTCCTTGATGGG - Intergenic
1201568694 Y:15391971-15391993 CCCAATATTCTCTCTCTGATGGG - Intergenic
1201631144 Y:16073109-16073131 CCCAATATTCTCTCTCTGATGGG + Intergenic
1201729704 Y:17190793-17190815 CCCAATATTCTCTCTGTGATGGG - Intergenic
1202146800 Y:21807003-21807025 CCCAATATTCTCTCCCTGATGGG - Intergenic
1202242760 Y:22788006-22788028 CCCAATATTCTCCCTCTGATGGG + Intergenic
1202395747 Y:24421756-24421778 CCCAATATTCTCCCTCTGATGGG + Intergenic
1202475038 Y:25248336-25248358 CCCAATATTCTCCCTCTGATGGG - Intergenic