ID: 1076022756

View in Genome Browser
Species Human (GRCh38)
Location 10:127087801-127087823
Sequence TTGGCTACAAATACACATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076022752_1076022756 23 Left 1076022752 10:127087755-127087777 CCAAAATAATTTGGTATTAATTG 0: 1
1: 0
2: 2
3: 58
4: 475
Right 1076022756 10:127087801-127087823 TTGGCTACAAATACACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076022756 Original CRISPR TTGGCTACAAATACACATCT TGG Intronic
No off target data available for this crispr