ID: 1076030137

View in Genome Browser
Species Human (GRCh38)
Location 10:127150336-127150358
Sequence CTGAGCAAAGAGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 783}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076030137_1076030151 29 Left 1076030137 10:127150336-127150358 CCCTCCCCTTTCTCTTTGCTCAG 0: 1
1: 0
2: 7
3: 64
4: 783
Right 1076030151 10:127150388-127150410 TCAGCAACTCTCAGCCACCAGGG No data
1076030137_1076030144 -10 Left 1076030137 10:127150336-127150358 CCCTCCCCTTTCTCTTTGCTCAG 0: 1
1: 0
2: 7
3: 64
4: 783
Right 1076030144 10:127150349-127150371 CTTTGCTCAGTGGGACCCTGAGG No data
1076030137_1076030145 -9 Left 1076030137 10:127150336-127150358 CCCTCCCCTTTCTCTTTGCTCAG 0: 1
1: 0
2: 7
3: 64
4: 783
Right 1076030145 10:127150350-127150372 TTTGCTCAGTGGGACCCTGAGGG No data
1076030137_1076030150 28 Left 1076030137 10:127150336-127150358 CCCTCCCCTTTCTCTTTGCTCAG 0: 1
1: 0
2: 7
3: 64
4: 783
Right 1076030150 10:127150387-127150409 ATCAGCAACTCTCAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076030137 Original CRISPR CTGAGCAAAGAGAAAGGGGA GGG (reversed) Intronic
900004816 1:37926-37948 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
900377036 1:2359577-2359599 AGGAGCAAAGAGGAAGAGGAAGG + Intronic
900779233 1:4606706-4606728 GTGAGGACAGAGAAAGGTGATGG - Intergenic
901174535 1:7289296-7289318 CTGAGCAAAGGGAAATGAGCAGG + Intronic
901636971 1:10674990-10675012 CTGAGCACAGAAAAACAGGAGGG - Intronic
902126516 1:14217110-14217132 AAGAGCAAAGAGAGAGGGAAAGG - Intergenic
903750686 1:25618406-25618428 CTGAGGCAAGGGAAAGGGGTGGG - Intronic
903892189 1:26577286-26577308 CTGAGCAAAGATGAGGGGGTGGG + Intergenic
904359844 1:29964157-29964179 GTGAGCAGAGAGAATGGGGTTGG + Intergenic
904594110 1:31632300-31632322 CTGAGCCAAGAGCCAGGGCAAGG - Intronic
904631548 1:31846511-31846533 CTGAGCCATGTGAAAAGGGAAGG - Intergenic
904740418 1:32670941-32670963 CAAAGCAAAGAGATAGGGTAAGG - Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905664942 1:39757705-39757727 CTGAGCAAAGAAAAGGGAAATGG + Exonic
905902396 1:41590218-41590240 CTGGGCAAAGAGAGAGGCCAAGG + Intronic
905934066 1:41809810-41809832 CAGATGAAAGAAAAAGGGGAAGG + Intronic
906039919 1:42780775-42780797 CTTAGCAGAGATAAAGAGGAGGG - Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906271935 1:44486217-44486239 CAGAACAAAGTGAAAGGGGGGGG + Intronic
906387232 1:45380644-45380666 CAGAGCAAAGAGAAAGAATAAGG + Intronic
906559186 1:46742548-46742570 GTGAGTAAAAAGAAAGGAGATGG + Intergenic
906583329 1:46954382-46954404 CTGACCACTAAGAAAGGGGATGG - Intergenic
906822563 1:48944727-48944749 TTGATCAAGAAGAAAGGGGAAGG - Intronic
907282446 1:53359934-53359956 CTGAGCAAAGAGGTAGAGGAGGG - Intergenic
907634731 1:56122630-56122652 CTGAGCAAAAAGAAAGCTGGAGG - Intergenic
907903587 1:58763920-58763942 TTGAGAATAGAGAAAGGGTAGGG - Intergenic
908017299 1:59856823-59856845 CTGAGCAAACAGGAAGGCAAAGG - Intronic
908237463 1:62160313-62160335 ATGATCAAAGATAAAGTGGAAGG + Intronic
908533633 1:65057021-65057043 TTGAGCAAAGAGAACAGAGATGG - Intergenic
908560769 1:65303922-65303944 CTGATCAAAGTGAAAGCTGAAGG - Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908651729 1:66340638-66340660 GTTAGCAAAGAGTGAGGGGATGG - Intronic
908930760 1:69313949-69313971 CAGAAGAAAGAGAAAGGAGAAGG + Intergenic
909467904 1:75994312-75994334 TTGAACAAAGAAAAATGGGAGGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910105517 1:83627603-83627625 ATGGGTATAGAGAAAGGGGAAGG + Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910487919 1:87736253-87736275 CTGAGCAATGAGACTGGGGCAGG + Intergenic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
913118430 1:115717754-115717776 GTGAGAGAAGAGAAAGGTGAGGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913538977 1:119800804-119800826 TTGAGGAAAGACAAAGGGGTGGG - Intronic
913567345 1:120085712-120085734 TTGATAAAAGATAAAGGGGAAGG - Intergenic
914823767 1:151125961-151125983 CTGAGCTAACTGAAGGGGGAGGG + Intergenic
915357827 1:155266896-155266918 CTGAGAAGAGAGATGGGGGAAGG + Intronic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916492542 1:165314641-165314663 CTAAAAAAAGAGAAAAGGGATGG - Intronic
916518787 1:165544648-165544670 CTGAGCACCGAGAAAGTGAATGG - Exonic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917728651 1:177852150-177852172 CTGACCAAAGAAATATGGGAAGG + Intergenic
918069162 1:181122393-181122415 CTGAGCAAGGAGACAGGGAGGGG - Intergenic
918132267 1:181639875-181639897 ATGAGTAAAGAGAAGGGGGTTGG + Intronic
918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG + Intergenic
918322260 1:183375441-183375463 CTGGGCAAAGGCATAGGGGAGGG - Intronic
918621669 1:186612697-186612719 CTGAGAAGAGAGAAAAGGGATGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919507352 1:198416131-198416153 CTGAAAAAACAAAAAGGGGAAGG + Intergenic
919608903 1:199720711-199720733 ATGTGCAAACAGAAAGGGGTGGG - Intergenic
919675215 1:200375462-200375484 GCAAGCAAAGAGAAAGGAGATGG - Intergenic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920903503 1:210136312-210136334 ATGAGTAAGGAGAAAGGGAACGG + Intronic
920938534 1:210458630-210458652 GTGAGCAAAGAGAAAGTGAAGGG + Intronic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
921622724 1:217343940-217343962 ATGAGAAAAGAGCAAGGGAAAGG + Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922179181 1:223220268-223220290 AGGAGGCAAGAGAAAGGGGAGGG - Intergenic
922843682 1:228665716-228665738 CAGAACAAAAAGACAGGGGAAGG - Intergenic
922974982 1:229777071-229777093 CTCACCAGAGAGTAAGGGGAAGG + Intergenic
923036848 1:230290469-230290491 CTGAGCACAGAGAACGGAGATGG - Intergenic
923051380 1:230393286-230393308 CGAAGAGAAGAGAAAGGGGAGGG + Intronic
1062823489 10:551602-551624 CTGGGCTCAGAGAAAGGTGAGGG + Intronic
1062907318 10:1187571-1187593 CTCCGCAAAGAGAAAGGAGAGGG - Intronic
1063082378 10:2780586-2780608 CTGAGCAGACAGAAATGGAAGGG - Intergenic
1063451533 10:6153550-6153572 CTCAGGAAAGAGGAGGGGGAGGG + Intronic
1063502737 10:6569812-6569834 GTGTTGAAAGAGAAAGGGGAAGG + Intronic
1063522043 10:6749985-6750007 CAGAGGAAAGAGAGAAGGGAAGG - Intergenic
1063977519 10:11429225-11429247 CTGATGAAACAGAAATGGGAGGG + Intergenic
1064044277 10:11997994-11998016 ATGAGCAAAGAGAAAGAGACAGG + Intronic
1064203305 10:13302166-13302188 CTGTGCAAACAGGAAGGGGCTGG - Intronic
1064303474 10:14144003-14144025 CTGAGCTAGTACAAAGGGGATGG + Intronic
1065113200 10:22459894-22459916 CTGTGCAAAGAGACAAGAGATGG - Intergenic
1065163180 10:22944812-22944834 CTGAGCAAAGAGGAATGGCTGGG - Intronic
1065167065 10:22990896-22990918 AGAAGCAAAGAGAAAGGGAAAGG - Intronic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065470001 10:26068424-26068446 CGAAGTAAAGAGAAAAGGGAAGG - Intronic
1065506672 10:26436576-26436598 CTGAGCAGAGTGAGATGGGAGGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1066224031 10:33365085-33365107 ATGAGCAAAGAGAAACTGGCTGG - Intergenic
1066334558 10:34462987-34463009 GGGAGGAAAGAGAATGGGGAGGG + Intronic
1066496860 10:35950467-35950489 CTGAGCAAAGACACACAGGACGG + Intergenic
1066637275 10:37517216-37517238 GTGAGCCAAGAAAAAGGAGAAGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067566431 10:47341058-47341080 CCCAGCAAATAGAAAGGGGGAGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067709822 10:48639099-48639121 CTGAGCTTAGAGAAGTGGGATGG - Intronic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1068078394 10:52287808-52287830 CTGAGCAGAGAGAAAAGGATAGG + Intronic
1068403797 10:56564133-56564155 CTGGCCAAAAAGAAAGGGAAAGG + Intergenic
1069070514 10:63986841-63986863 ATGAGCCAACAGACAGGGGAAGG - Intergenic
1069381742 10:67849205-67849227 GTCAGAAAAAAGAAAGGGGAGGG + Intergenic
1069763827 10:70836569-70836591 CTCAGGAAAGGGAAAGGGAAAGG - Intronic
1069906888 10:71737273-71737295 CTGAGCAAACAGAAAGTGAAGGG - Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070609770 10:77925717-77925739 CTGAGCAGAGAAAAAGGAGCTGG + Intronic
1070701901 10:78609928-78609950 CTGGGCAGAGAGAAATGAGAGGG - Intergenic
1072479250 10:95794786-95794808 CTAAGCAAAGAGGATGGGAAGGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073356461 10:102858873-102858895 CTGACCCAAGAGAACAGGGAAGG + Intronic
1073440389 10:103549225-103549247 CTGAGCAAACAGAACCTGGATGG - Intronic
1074418383 10:113287038-113287060 CTGAGCAAAGGGCAAGCAGAGGG - Intergenic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075892104 10:125960940-125960962 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1077035157 11:490946-490968 CTGACCAGGCAGAAAGGGGAGGG - Exonic
1077200292 11:1303539-1303561 CTGTGCAAAGAAACAGGGCAAGG + Intronic
1077295934 11:1826348-1826370 CCGAGCAAGTAGAAAGGGGGCGG + Intergenic
1077810538 11:5632232-5632254 CTGAGAAGATTGAAAGGGGATGG - Intronic
1078100704 11:8328823-8328845 GTGAGCAGAGAGGATGGGGAGGG - Intergenic
1078212971 11:9286106-9286128 CTCAGGGAAGAGGAAGGGGAAGG + Intronic
1078575059 11:12494309-12494331 CCGACCCATGAGAAAGGGGAAGG - Intronic
1078781263 11:14441400-14441422 CTAAGAAAAGAAAAAGTGGATGG + Intergenic
1078899516 11:15628557-15628579 CTGAGCCAATTCAAAGGGGAGGG + Intergenic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1079129521 11:17739106-17739128 CAGAGCAAAGACAGAGGGGGAGG - Intronic
1079246845 11:18758738-18758760 CAGACCAAAGAGAAAGGTAATGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081492001 11:43576548-43576570 GGGAGGAAAGAGAAAGTGGATGG - Intronic
1081860614 11:46331565-46331587 CTGAGCAAAGGCACAGGGCAGGG + Intergenic
1082002826 11:47403103-47403125 CTGAGACAAGAGAAGGGGAATGG + Intergenic
1082085262 11:48044737-48044759 GTGACCAAAGCTAAAGGGGAAGG + Intronic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082790367 11:57342771-57342793 CTGGGCAGAGGGAAAGGGGGAGG - Intronic
1082909488 11:58354126-58354148 CTGGGAAAAAAGAAATGGGAAGG - Intergenic
1082958311 11:58895493-58895515 CTGAGAAAAGAGGAATGAGAAGG - Intronic
1083266793 11:61550594-61550616 CTCAGCAAAGAGGAAGGGGCTGG + Intronic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083755305 11:64788942-64788964 CTGAGCAAGGATGCAGGGGAAGG + Intronic
1084275117 11:68047451-68047473 CACAGCAAACAGGAAGGGGAAGG - Exonic
1084405655 11:68971367-68971389 CTGGACAAAGAGGAAGGAGAAGG - Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084608128 11:70184322-70184344 CTGTGAAAAGAGGAAGGGGCTGG + Intronic
1085029369 11:73260330-73260352 CTCTGCAAAGACAAAGAGGATGG - Intergenic
1085118626 11:73952229-73952251 ATGAGGCCAGAGAAAGGGGAGGG + Intronic
1085341611 11:75735058-75735080 GTGAGCAAACACAGAGGGGAGGG + Intergenic
1085454348 11:76657231-76657253 CTGAGCACAGAGAAGGGGAGGGG + Intergenic
1085512447 11:77095284-77095306 CTGAGCTCAGAGAAGGGGGTGGG - Intronic
1085567704 11:77529733-77529755 ATGAGCAGAAAGTAAGGGGAGGG + Intronic
1085647682 11:78237680-78237702 CTGAGCAGAGAGAAAAGGATTGG + Intronic
1085958867 11:81435680-81435702 TGAAACAAAGAGAAAGGGGATGG - Intergenic
1086496677 11:87411162-87411184 CTCAGTGAAGAGAGAGGGGAAGG - Intergenic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087279528 11:96194747-96194769 CTGAGAATAAAGAAAGGGAAAGG - Intronic
1087294038 11:96348891-96348913 CTGAGCAAAAAGAAAAAGGCTGG - Intergenic
1088389478 11:109298362-109298384 CTGAGCAGAGAGAGAGAGGTGGG + Intergenic
1088437335 11:109829777-109829799 CTAAGCAAAGTGAAAAGGAATGG - Intergenic
1088661583 11:112052759-112052781 CTGACCTAAGGGAAAGGGGAGGG - Intronic
1088987036 11:114918245-114918267 CTGAGGAGAGAAAAAGGGGGCGG - Intergenic
1089545128 11:119218308-119218330 CTGAGGAGACAAAAAGGGGATGG + Intronic
1089714333 11:120342493-120342515 CTAAGCAAAGAGTAAGGGAAGGG - Intronic
1089846587 11:121463518-121463540 TTTAGCAAAGAGAAAGGAAAGGG + Intronic
1089884540 11:121806928-121806950 CTGAGCGAAGAGCATGGGGATGG + Intergenic
1090429269 11:126632609-126632631 CTGAGAGTAGAGAGAGGGGAAGG - Intronic
1090431958 11:126653679-126653701 CAGGGCAATGAGAAACGGGAGGG + Intronic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091378227 12:39977-39999 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1091921251 12:4306644-4306666 CAGAGCAAAAAGATAGGGAAAGG - Intergenic
1091940266 12:4473129-4473151 GTGAGCAGAGAGGAAGGGGCAGG + Intergenic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092266080 12:6981633-6981655 CTGAGCAGAGAGAGAACGGATGG + Intronic
1092524595 12:9302035-9302057 GGGAGCTAAGAGAAAAGGGAAGG - Intergenic
1092542670 12:9429777-9429799 GGGAGCTAAGAGAAAAGGGAAGG + Intergenic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093889236 12:24499455-24499477 ATGAGCAAATACAAAAGGGAAGG + Intergenic
1094280289 12:28729803-28729825 CTAGGCAAAAACAAAGGGGACGG + Intergenic
1094510342 12:31092653-31092675 GGGAGCTAAGAGAAAAGGGAAGG - Intronic
1094564513 12:31588048-31588070 AAGATCAAAGAGAAAGGGCAGGG - Intronic
1095614456 12:44171869-44171891 CCAAGCAGAGAGAAAGTGGAGGG + Intronic
1095953751 12:47795343-47795365 CTGGGCAAAGTGGAAGGGCAAGG + Exonic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1096911365 12:54987790-54987812 GGGAAAAAAGAGAAAGGGGAAGG - Intergenic
1097237235 12:57548937-57548959 CTAGGCAAAGAGGAAGGGCAGGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097445350 12:59664796-59664818 TTGAGAGAAGAGAGAGGGGAGGG + Intronic
1098028524 12:66230838-66230860 CTGAGCTAAGAGAAAAGGATGGG - Intronic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1098859824 12:75695758-75695780 ATGAGCAAGGAGAAAGGAGAAGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099258995 12:80352639-80352661 CAGGGAAAAGAGAAAGGGAAGGG - Intronic
1099851629 12:88105346-88105368 CTTAAAAAAGAGAAAGCGGAGGG + Intronic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100496407 12:95129175-95129197 GGGAGGAAAGAGAAAAGGGAAGG + Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101648209 12:106651127-106651149 CTGAGTAAAGAGAGAAGGAAAGG - Intronic
1102028861 12:109728571-109728593 CTGAGCAAAGGCACAGAGGAAGG - Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103998956 12:124847991-124848013 CCCAGCAAAGAGAAAAGGGCTGG + Intronic
1104397328 12:128445603-128445625 CTCAGCAGAGAGACTGGGGATGG - Intronic
1104720577 12:131043103-131043125 CTGAGCAAAGAGCAAAGTGCAGG + Intronic
1104734855 12:131130553-131130575 CTGCGCGAGGAGGAAGGGGAAGG + Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105932736 13:25067894-25067916 CTGTGAAAAGAGAAAGAGGTAGG + Intergenic
1106672739 13:31923895-31923917 GTTGGCCAAGAGAAAGGGGAAGG + Intergenic
1107203545 13:37752601-37752623 CTTAGCAAAGAAAAAGGGTGTGG - Intronic
1107399328 13:40053684-40053706 GTGAGCAGAGAGAAAAGGCATGG - Intergenic
1107411898 13:40165604-40165626 CTCAGCAAAAAGAGAGGTGAAGG + Intergenic
1107562446 13:41570434-41570456 CTGAGCATACAGAAAAGGGCAGG - Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107892975 13:44930467-44930489 CTGAGCAGAGAGAGATGGGGAGG - Intergenic
1108446299 13:50512150-50512172 CTGAGAAAAGAGGATGGGGGAGG + Intronic
1108496700 13:51032664-51032686 CAGAGAGAAAAGAAAGGGGAAGG + Intergenic
1108508982 13:51137623-51137645 GGGAGGAAAGAGAAAGGGAAGGG - Intergenic
1108548956 13:51523943-51523965 CAGAGCAAAGGGGAAGGTGAAGG - Intergenic
1109272390 13:60268831-60268853 CAGAGTAGTGAGAAAGGGGAAGG + Intergenic
1109507798 13:63329407-63329429 TAGAGCAAAAAGATAGGGGAAGG + Intergenic
1109820642 13:67648081-67648103 TTGAAAAAAAAGAAAGGGGAAGG + Intergenic
1110481476 13:75982549-75982571 CTGAGCAAAGAATAATGAGAAGG - Intergenic
1111944282 13:94647495-94647517 CAAAGGAATGAGAAAGGGGATGG + Intergenic
1112215770 13:97430482-97430504 CTGATTAAACATAAAGGGGAAGG - Intergenic
1112614563 13:100990089-100990111 TCAGGCAAAGAGAAAGGGGAGGG + Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113355679 13:109577690-109577712 GTGAGTAAAGAGAAAGGGGTGGG - Intergenic
1113424048 13:110193296-110193318 TCAACCAAAGAGAAAGGGGATGG - Intronic
1114748563 14:25177932-25177954 CTTAGCAAAAAAAAAGGGGGGGG - Intergenic
1115753273 14:36510810-36510832 CAGAGCACAGGGACAGGGGAAGG + Intronic
1116287905 14:42996418-42996440 CTGAGGAAAGGGAAAGGGAAAGG - Intergenic
1116400030 14:44495440-44495462 CTCAGCTAAGAGAAAGGGATTGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116627711 14:47287279-47287301 GTTAGCAAAGAGGAAGGGGTGGG + Intronic
1118019304 14:61695203-61695225 CGGAGGAAAGAGAAAGGAGATGG - Intergenic
1118137098 14:63042142-63042164 CAGAGCAGAGAGAAAGGGGTGGG - Intronic
1118595677 14:67433335-67433357 CAGAGAGAAGAGAAAAGGGAGGG + Intergenic
1118602702 14:67481775-67481797 CTGAGCAAGGAGCTAGTGGAAGG - Intronic
1118607378 14:67514301-67514323 CTGAGCATAGAAAGAGGGAAAGG + Intronic
1118821480 14:69349003-69349025 CCAAGCAAAGAAAAAGGGGTAGG - Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119583478 14:75809716-75809738 CTGAGAAGGGAAAAAGGGGAAGG - Intronic
1119660788 14:76450306-76450328 GTGAGCAAAGGCAAAGTGGAAGG + Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1119789931 14:77341158-77341180 CTTAGGAAAGAGAAAGGAGGGGG + Exonic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1119954749 14:78784870-78784892 CTGAGCAAAGTCACAGGGGCAGG + Intronic
1120255015 14:82107452-82107474 GTAAGGAAAGAGAGAGGGGAAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121515719 14:94548595-94548617 CTGAGGAGAGAGGGAGGGGATGG - Intergenic
1121593309 14:95137321-95137343 AAGAGGAAAGGGAAAGGGGAAGG + Intronic
1121627947 14:95400375-95400397 CTGATGAAAGACAATGGGGAAGG + Intergenic
1121863378 14:97339957-97339979 ATGAGCCAAGGGAAAGGAGAAGG - Intergenic
1121908966 14:97771649-97771671 CTAAGCAGAGAGAAAGGACAGGG - Intergenic
1122206021 14:100148434-100148456 ATGAGAAAGGAGGAAGGGGAAGG - Intronic
1122334593 14:100962567-100962589 CTGAGCAAAGGAAATGGGGAAGG + Intergenic
1122359962 14:101153245-101153267 CCCAGCAAAGAGGAAGGAGAAGG - Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122832065 14:104403222-104403244 CTGATGAAAGGCAAAGGGGAAGG - Intergenic
1124217167 15:27816957-27816979 CTGAGCGGAGACATAGGGGAAGG - Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125761665 15:42100349-42100371 CTAAGCAAGGATAAAGGGAAGGG - Intergenic
1125872597 15:43115587-43115609 GAGAGAAAATAGAAAGGGGAAGG + Intronic
1126212870 15:46119764-46119786 CAGACCAAAGACAGAGGGGAGGG - Intergenic
1126300915 15:47195333-47195355 CTGGGCAGAGATAAAGGGCAGGG - Intronic
1126885727 15:53147771-53147793 TTGAGGAAAGAGAAAGAGTAAGG + Intergenic
1127064863 15:55226383-55226405 AGGAGCAAAGGGAAAGGGGAGGG + Intronic
1127813519 15:62585487-62585509 CTGAGCAAGTAGGAAGGGGTTGG + Intronic
1128908294 15:71489044-71489066 CTCAGCCAACAGAAAGGTGATGG - Intronic
1129051623 15:72785992-72786014 CTGAACAAAGAGGAAAGGGCTGG + Intergenic
1129163768 15:73763451-73763473 CTGAGCTCAGAGAATGGGGTAGG - Intergenic
1129808056 15:78481138-78481160 CTGTCCCTAGAGAAAGGGGATGG + Intronic
1129815856 15:78553127-78553149 CGGAGGACAGAGAAAGAGGAAGG + Intergenic
1129917991 15:79291648-79291670 AGGAGAAAAGAGGAAGGGGATGG + Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130730819 15:86490230-86490252 ATGATGAAAGAGCAAGGGGAGGG - Intronic
1130746253 15:86657088-86657110 CTGAGAAACGAGGAAGGTGAGGG - Intronic
1130891512 15:88137564-88137586 GTCGGCAAAGAGAGAGGGGAAGG + Intronic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131579046 15:93622876-93622898 CTGATCAAAGAGAAAAATGAAGG - Intergenic
1131660475 15:94509953-94509975 CTGAGCAAAGAGAAAAAAGCTGG + Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1132448694 15:101953018-101953040 CTGAGTAAAGTTGAAGGGGAGGG - Intergenic
1132924361 16:2420794-2420816 CTAAGAAAGGAGGAAGGGGAAGG - Intergenic
1133027095 16:2993202-2993224 CTGAGCAGAGAGGAAGGGATGGG + Intergenic
1133452591 16:5916403-5916425 ATGAGCAAAGAGATTGGGAAAGG - Intergenic
1133589821 16:7231243-7231265 CTGGGCAAAGAAATAAGGGAGGG + Intronic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1133895146 16:9919993-9920015 CGGAGCAGAGAGTAAAGGGATGG - Intronic
1134213100 16:12294612-12294634 CTGAGCATAGGCAAAGGGCAGGG - Intronic
1134323187 16:13182377-13182399 CTGATCAAAGAGGAAAGGAAAGG - Intronic
1134360669 16:13528231-13528253 CTGAGCAAGGGGAAAGGTGAGGG - Intergenic
1134600775 16:15531915-15531937 ATGCCCAAAGAGAAATGGGAGGG + Intronic
1135201920 16:20444953-20444975 TTGAGCAAACCGAAAGGTGAGGG + Intergenic
1135217184 16:20582913-20582935 TTGAGCAAACCGAAAGGTGAGGG - Intergenic
1136045082 16:27609060-27609082 CTGGGCAACAAGAAAAGGGAAGG - Intronic
1136232443 16:28894617-28894639 CTGAGCCAACTGGAAGGGGAAGG - Intronic
1136266981 16:29127656-29127678 CTAAGCAAAGAGCAGGGGCAGGG + Intergenic
1136294713 16:29295043-29295065 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1137027219 16:35489065-35489087 GTGCGCAATGAGCAAGGGGACGG - Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1139470492 16:67175473-67175495 CTGAACATGGAGCAAGGGGAGGG + Exonic
1140056290 16:71528625-71528647 TTGAGCAAAGAGAGAGAGAATGG - Intronic
1140616566 16:76671439-76671461 CTGAGCTTAGGGATAGGGGAGGG + Intergenic
1140718502 16:77748974-77748996 GTGAGAAAAGAGAAAAGAGAAGG - Intergenic
1141058731 16:80843609-80843631 CTGGGCAAAGAAGAAGGAGAAGG + Intergenic
1141159952 16:81622576-81622598 CTGAGCTAAGAGAAAATGCAAGG - Intronic
1141417909 16:83891050-83891072 CTGAGTAAAGAGAAGCGGAATGG - Intergenic
1141602783 16:85136624-85136646 CTGCGCACAGAGCACGGGGAGGG - Intergenic
1141827071 16:86488045-86488067 ATGGGCACAGAGAAAGGGCACGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142070269 16:88087979-88088001 CTAAGCAAAGAGCAGGGGCACGG + Intronic
1142100616 16:88269087-88269109 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143104575 17:4522578-4522600 CTGAGAGAAGAGAAAGAGGGAGG - Intronic
1144036097 17:11367349-11367371 GGGAGGACAGAGAAAGGGGATGG + Intronic
1144431464 17:15196022-15196044 CTAAGCAAAAAGCAAGAGGAAGG + Intergenic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1145118783 17:20236837-20236859 CTGTGAAAATAGAAACGGGAGGG - Intronic
1145921697 17:28614570-28614592 CTTAGCACAGAGACTGGGGAGGG + Exonic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146724941 17:35148950-35148972 CTGAGGAAAGGGGAAGGAGAAGG - Intronic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147588722 17:41667544-41667566 CTGAGCAAAGGCACAGGGGCAGG + Intergenic
1147595971 17:41717524-41717546 CTCAGCCAAGAGACATGGGAGGG + Intergenic
1147608818 17:41789326-41789348 CTCAGCAAAGAGGCAGGGTAGGG + Intergenic
1148752295 17:49952190-49952212 CTGAGCAAAGAGTCTGTGGATGG - Intergenic
1149446055 17:56714266-56714288 CTGGGCAAAGAGACATAGGAAGG + Intergenic
1150069694 17:62140279-62140301 CTGGGCAAAGAGACTGGAGAAGG - Intergenic
1150821188 17:68435774-68435796 AGGAGAAAAGAGGAAGGGGAGGG - Intronic
1152149518 17:78590153-78590175 CCGAGCAGAGAGGAAGGGCAGGG - Intergenic
1153585495 18:6616149-6616171 ATGTGCAAAGAGACAGAGGAGGG + Intergenic
1153664242 18:7353999-7354021 CTATTCAGAGAGAAAGGGGATGG - Intergenic
1153770052 18:8408109-8408131 CTTAGCAAAGAGAACTGGGTGGG - Intergenic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156447459 18:37248296-37248318 GTGAGCAAAGAAAGAGGGTAAGG - Intronic
1156561374 18:38129603-38129625 CAGTGAGAAGAGAAAGGGGAAGG - Intergenic
1156892688 18:42208241-42208263 GTGGGCAAAAAGAAAGGGGTTGG + Intergenic
1157280977 18:46346120-46346142 CTGGGCAGAGAGAGAAGGGATGG + Intronic
1157370863 18:47110035-47110057 GAGAGCAAGGAGAAAGGTGAAGG - Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158735982 18:60080054-60080076 CTGAGCAAAGAGAACGAAGCTGG + Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159840330 18:73391916-73391938 CTGAGGAAAGAGCCAGGTGATGG - Intergenic
1160636568 19:79535-79557 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1161200951 19:3014515-3014537 CTGGGCACAGAGCAAGGGGTGGG - Intronic
1161363436 19:3864535-3864557 CTAAACAAAGAGAAAGGTAACGG + Intronic
1161984430 19:7645853-7645875 GAGAACAGAGAGAAAGGGGAAGG - Intronic
1162115150 19:8424689-8424711 CAGAGCCAAGAGACAGGGAAAGG - Intronic
1162283493 19:9719520-9719542 CTGAGGGAAGAGAGAGTGGAAGG - Intergenic
1162787851 19:13046767-13046789 AGGAGCAGAGAGAAAGGGAAGGG + Intronic
1163351336 19:16777890-16777912 GGAAGGAAAGAGAAAGGGGAGGG + Intronic
1163662580 19:18587657-18587679 ATGGACAAAAAGAAAGGGGAGGG + Intronic
1164111385 19:22162646-22162668 CTCAGAAAACAGAAAGGGAAGGG + Intergenic
1164465397 19:28483339-28483361 CAGAGGGAAGAGAAAGGAGAAGG - Intergenic
1164524571 19:29003928-29003950 GGGAGCACAGAGAAAGGGGGTGG - Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165632125 19:37310815-37310837 CTGAGCAAGGAGAGAGGTAAAGG + Intergenic
1166942757 19:46376646-46376668 CTGAGCAAAACGACAGGAGAAGG + Intronic
1166965167 19:46525569-46525591 CTGAGCAAAATGACAGGAGAAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167115964 19:47489225-47489247 CTGGGAACAGAGAAAGGGAAGGG + Intronic
1167424488 19:49423133-49423155 AGAACCAAAGAGAAAGGGGACGG - Intronic
1168069232 19:53940620-53940642 ATGAGGTTAGAGAAAGGGGAAGG - Intronic
1168298374 19:55388991-55389013 CAGCTCAAAGAGACAGGGGAGGG - Intronic
1168670050 19:58234209-58234231 CTGAGCATAGAGAAAGGCAAGGG - Intronic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
925902991 2:8521835-8521857 ATGAGAAAAGAGGAAGGGGCTGG - Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926628906 2:15119163-15119185 CTGAGCAGGGAGAGAGGGAAGGG + Intergenic
926965231 2:18402343-18402365 TGGAGAAAAGAGAAAGGAGAGGG - Intergenic
926999083 2:18773473-18773495 CTGAATAAAGAGAAAAGTGAGGG - Intergenic
927631545 2:24778472-24778494 AGGAGGAAAGAGAAAGGGGGAGG + Intergenic
927989885 2:27440625-27440647 ACGAGAAAAGAGAAAGGAGATGG - Intronic
928184770 2:29100656-29100678 CTGAGCAAAGAGGAAGGCTCTGG + Intronic
928314302 2:30233785-30233807 CTGGGGCTAGAGAAAGGGGATGG + Intronic
928325527 2:30316587-30316609 CTGATCAAAGAGAGATGTGAAGG + Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929249768 2:39739811-39739833 CTGAGCAAGGAAGAAGTGGATGG + Intronic
929440316 2:41961011-41961033 TTGGGCAAAGAGACTGGGGATGG - Intergenic
929872594 2:45771613-45771635 CTAAGAAAAGACAAAGGGGGAGG - Intronic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930215594 2:48693145-48693167 CTGAGCAAGAAGAGAGGGAAGGG + Intronic
930710973 2:54550947-54550969 AGGAGAAAAGAGAAAGGTGAGGG - Intronic
931242950 2:60468530-60468552 GTGAGGAAAGAAAAAGGGGAGGG + Intronic
931322377 2:61183554-61183576 TTGAGTAAAAAGAAAGGAGATGG + Intronic
931752334 2:65341028-65341050 CTAAGGAGAGAGAAAGGGGCGGG + Intronic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
932144616 2:69306809-69306831 CCGAGCAGAGAGAGCGGGGAGGG + Intergenic
933068701 2:77832210-77832232 GTGAGCCAACAGACAGGGGAAGG - Intergenic
933549333 2:83755180-83755202 CTGATCAAAGAGAAAGCTTAGGG - Intergenic
934514888 2:94980572-94980594 CTGAGCAGAGAGGGAAGGGAAGG - Intergenic
934702016 2:96449985-96450007 CTGAGCAAGGAGATAGTAGATGG - Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935468063 2:103423152-103423174 CTGAACAAAGAGAAAAGAGTAGG + Intergenic
935959103 2:108406889-108406911 TTGAGAAAAGAGGAAGGGAAAGG - Intergenic
936564912 2:113575505-113575527 CTGAGTAAAGTTGAAGGGGAGGG - Intergenic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937505062 2:122527688-122527710 ATGAGCAAAGACAAAGGACATGG - Intergenic
938080473 2:128367395-128367417 CTGAGCAAAGGCAGTGGGGAAGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938338720 2:130521308-130521330 CTCAGCCAGGAGAAACGGGATGG - Exonic
938351120 2:130599442-130599464 CTCAGCCAGGAGAAACGGGATGG + Exonic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938600930 2:132838234-132838256 TTGAGCAAATAGCAAAGGGAAGG - Intronic
938623609 2:133084046-133084068 CTGAGCACAGAAAACGGGGAAGG + Intronic
938745019 2:134269375-134269397 CTGAGTTAAGACAAACGGGAAGG - Intronic
938755730 2:134377327-134377349 CTAAGCAGAAAGAAAGGTGAAGG + Intronic
939275507 2:139992479-139992501 GGGAGCAAAGAGATTGGGGACGG - Intergenic
939575879 2:143893899-143893921 CAATGCAAAGAGAAAGGGGCCGG - Intergenic
940160581 2:150708331-150708353 GTGAGGCAGGAGAAAGGGGAGGG + Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940268724 2:151868236-151868258 TTTAGCAAAGAGAAAGTGAATGG + Intronic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940850979 2:158688067-158688089 CTCAACAAAGAGAAAGGAGTTGG + Intergenic
941095011 2:161229142-161229164 TTGGGCAAAGAGTAATGGGAGGG + Intronic
941155533 2:161973134-161973156 CTGATGAAAGAAAAAAGGGATGG - Intronic
941640897 2:167987234-167987256 CAGAGAAAAGGGGAAGGGGAAGG - Intronic
942066349 2:172275318-172275340 CTGAGCAAGGAAGAAAGGGAAGG - Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942249899 2:174038683-174038705 AAGAGAAAAGAGAAACGGGAAGG - Intergenic
942791977 2:179771009-179771031 CTTCCCAAAAAGAAAGGGGAGGG + Intronic
944067744 2:195637035-195637057 ATTAACAAAGAAAAAGGGGAGGG + Intronic
944425821 2:199582064-199582086 CTGAGAACAGAGAAAGGAAATGG - Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
946166247 2:217865814-217865836 TTGAGCAAAGAAAGAGGGGCAGG + Intronic
946353272 2:219169286-219169308 GTGAGCACAGAGCAAGGGCAAGG - Exonic
946360702 2:219218005-219218027 CTAAGCAAAGGGAGAAGGGAGGG - Intronic
946748885 2:222872757-222872779 CTGATCTAGGAGAAGGGGGATGG + Intronic
947255053 2:228154109-228154131 GTGAGAAAAGAGAAAGTAGATGG - Intronic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947614806 2:231548964-231548986 CTGGGCAAAGAGCCAGGGAAAGG - Intergenic
948482542 2:238259269-238259291 CTGAGCACAGAGAATGAGCAAGG + Intronic
948495870 2:238349470-238349492 CTCCGCTAAGAGAAGGGGGAGGG + Intronic
948632246 2:239309746-239309768 ATGAGCGAAGGGGAAGGGGATGG - Intronic
948990288 2:241550632-241550654 CTGGGAAAAGTGAATGGGGAGGG + Intergenic
1168849921 20:969513-969535 CTGTTCAAAGAGGAATGGGAAGG - Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1168868190 20:1107048-1107070 GTGAGCAAGGAGGAATGGGAGGG - Intergenic
1168989253 20:2080167-2080189 CTGAAAAAAGAAAAAGGGGAAGG - Intergenic
1169142432 20:3234003-3234025 CTGAGGAAAGAGTGAGGGGGAGG + Intronic
1169990579 20:11498486-11498508 CTGAGCAAAAACAAAGGGTAGGG + Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170215820 20:13889913-13889935 CTGAGCACAGAGCAAGATGATGG + Intronic
1170952792 20:20951901-20951923 CTGAGACAAAAGAAAGGGGATGG + Intergenic
1171782320 20:29430605-29430627 CTGCGGCAAGAGCAAGGGGACGG - Intergenic
1172448039 20:35003284-35003306 CTGGGCAAAGAGGGAGGGGCTGG + Intronic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173248506 20:41352260-41352282 CTGAGCCCAGAGGATGGGGAGGG + Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173864502 20:46305678-46305700 CTGATGGAAGAAAAAGGGGAGGG + Intronic
1174217695 20:48929804-48929826 TTGAGCAAAGAGAGTGGAGATGG + Intronic
1174486707 20:50865845-50865867 CTGCCCACAGAGAAATGGGAGGG + Intronic
1174582101 20:51579378-51579400 CTGGGCCCAGGGAAAGGGGAAGG + Intergenic
1174832628 20:53826800-53826822 CTGAGCAAAGCAGAAGGAGATGG + Intergenic
1175489353 20:59368955-59368977 TTGAGCAAAGGGAGAGGGGCTGG + Intergenic
1177862699 21:26473563-26473585 CTGAGCACAGTGAAGGGGGTGGG - Intronic
1178014159 21:28323779-28323801 CAGAACAAAGAGAAAAGAGAGGG - Intergenic
1178850302 21:36207568-36207590 CTCAGCTAAAAGACAGGGGAAGG - Intronic
1178958319 21:37042699-37042721 CAGAGCAGAGGGAAAAGGGACGG - Intergenic
1179625172 21:42645195-42645217 CTGCGCAAAGGGGATGGGGAGGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180638441 22:17279109-17279131 CAGTGCAAAGAGCAAGGGAAGGG - Intergenic
1181266075 22:21631758-21631780 CTGAGCAAAGGGGAAAAGGAGGG + Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1183013464 22:34966864-34966886 ATGAGTAAACAAAAAGGGGACGG - Intergenic
1183247577 22:36705629-36705651 TTGAGAAAAGGGAAAGGGGTGGG + Intergenic
1183253070 22:36743993-36744015 ATGACCTAAGAGGAAGGGGAAGG - Intergenic
1183342057 22:37286913-37286935 CTGAGCAAAGCGATAGCGGCTGG + Intronic
1183353936 22:37348685-37348707 CTGAGGACAGAGAGAGGGAAGGG - Intergenic
1184110027 22:42389090-42389112 CTGGTCACAGAGAAAAGGGAGGG + Intronic
1184345660 22:43911128-43911150 CTGAGAAAGGAGGGAGGGGAGGG - Intergenic
1184673241 22:46026800-46026822 ATGTGCAAAGAGAAAGGACAGGG - Intergenic
950772732 3:15325025-15325047 CTGAGCAATGAGGAAAAGGACGG + Intronic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951575245 3:24106849-24106871 GTGGTGAAAGAGAAAGGGGAAGG + Intergenic
953163823 3:40446331-40446353 ATGAGGAAAGAGAAAGGATAGGG + Intergenic
953327567 3:42025535-42025557 CTGTTCAAAGGGAGAGGGGAAGG + Intronic
953357659 3:42268005-42268027 CTGAGCAGAGAGACACTGGAGGG + Intergenic
953787454 3:45921841-45921863 CTGAGGAAACAGAAATGGAAAGG + Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953860648 3:46541506-46541528 AAGGGCAAAGAGAAAGGGAAAGG + Intronic
954929227 3:54266462-54266484 CTGTGGAAAGAGAAAGGTGTTGG + Intronic
955214080 3:56970588-56970610 CTGAGCACAGAGACAGTGCAGGG - Intronic
955878174 3:63515619-63515641 CTGAGAAAAAAGAACAGGGAAGG + Intronic
956002194 3:64741350-64741372 CTGAGAAAAGAGTAAGGGTGGGG - Intergenic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956541290 3:70342833-70342855 CTGGCCAAAGAAAAAGGGCAAGG - Intergenic
956573417 3:70723458-70723480 ATAAGCAAACAGAAAGGTGAGGG + Intergenic
956716360 3:72083673-72083695 GTGAGCAAAGAGAATTTGGAGGG - Intergenic
957880298 3:86203383-86203405 CTGAGCAAGGACAGAGGGAAGGG + Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
958838960 3:99180037-99180059 CTGAGCAGGGAGAAAGGGAAGGG + Intergenic
958899848 3:99872839-99872861 CTGGGCAAACAAAAATGGGAAGG - Intronic
959005912 3:101019731-101019753 CTGAACACAGGGCAAGGGGAGGG - Intergenic
959311691 3:104745948-104745970 CTGAGAAGAGAGTAATGGGAAGG + Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960053461 3:113259319-113259341 CTAAGCTAAGAGAAAAGGGAAGG + Intronic
960092058 3:113650818-113650840 CTGGGGAAAGAGAAAGGAGGGGG - Exonic
961096427 3:124160412-124160434 CTGTGCAGAGAGAAGGGTGATGG + Intronic
961131212 3:124468757-124468779 TTAAGGAAAGAGGAAGGGGAAGG + Intronic
961714195 3:128847568-128847590 CTGGGCAGGGAGGAAGGGGAAGG + Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962196152 3:133365407-133365429 CTCAGGAAAGAGAAAAGGGAGGG + Intronic
962432299 3:135330470-135330492 CGAGGCAATGAGAAAGGGGAGGG - Intergenic
962774036 3:138641686-138641708 CTGAGCAAAGAAAACTGGGCAGG - Intergenic
963088774 3:141462853-141462875 CCTAGCAAAGAGGAAAGGGATGG + Intergenic
963179221 3:142336493-142336515 CTGAGGAAAGAAGCAGGGGAAGG + Intronic
963376649 3:144475183-144475205 ATAAGCAAAGAGACAGGAGAAGG + Intergenic
963608314 3:147433471-147433493 CTGAGTAAAGAGAAAGGTAAAGG + Intronic
964849335 3:161078206-161078228 GTGAGGAGAGAAAAAGGGGAAGG + Exonic
964998265 3:162916499-162916521 CTGAGCAAAAATAAAGCTGAAGG - Intergenic
965410906 3:168329962-168329984 CTGAGCGAAAAGAAAATGGATGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
966077830 3:175959989-175960011 CTGAGAAAATAGGAATGGGATGG - Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966342986 3:178945966-178945988 CTGCACAAAGAGAAAGTGTATGG + Intergenic
966621490 3:181969122-181969144 CTGAGCCAATAAAAAGGGAAGGG + Intergenic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967559832 3:190905011-190905033 CTCAGAAGAGAGAAAGGTGAGGG + Intergenic
967721420 3:192820107-192820129 CTGTGGGGAGAGAAAGGGGAGGG + Intronic
967808801 3:193737748-193737770 CTGAACAAAGTGGGAGGGGAGGG - Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968382936 4:110601-110623 CAGAGCAAAGGGCAAGGGGGAGG + Intergenic
968589499 4:1450333-1450355 CTGAGCTCTGGGAAAGGGGAGGG + Intergenic
968638300 4:1695017-1695039 TCCAGCAAAGAGAAAGCGGATGG + Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970407211 4:15775211-15775233 TTCAGCAAAGAGAACTGGGAAGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970652890 4:18197954-18197976 CTGGGAAAAGAGAATGGAGAGGG - Intergenic
970710147 4:18852208-18852230 ATGAGAAAAGAGAGAGGTGATGG - Intergenic
971032827 4:22659513-22659535 TTGAGAATAGGGAAAGGGGAAGG + Intergenic
971146431 4:23981555-23981577 CTGACCAAAGAGAAGGGGCCAGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971352038 4:25863230-25863252 AGGAGCAGAGAGAAAGGGAAAGG - Intronic
971504871 4:27355650-27355672 GTAATCAAAGAGAAACGGGATGG - Intergenic
973604285 4:52571204-52571226 CTGGGCAAGGAGAGAGGGCAGGG - Intergenic
974218756 4:58936912-58936934 CTGAGGAAAGAGAAAGAAGTAGG + Intergenic
975096209 4:70460400-70460422 AAGAGCAAAAAGAAAGGTGATGG + Intronic
975727959 4:77310475-77310497 CTAAGCAAAAAGGAAGGTGAAGG - Intronic
976339267 4:83927729-83927751 CTGAGAAATGAGCAATGGGAGGG + Intergenic
976973630 4:91139026-91139048 TTGAGCAAAGAGGAAGGGAGAGG - Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
978486987 4:109265948-109265970 CTGAGAAAAGAGAAGGGCTATGG - Intronic
979233030 4:118368028-118368050 CTGAGAAAAGAGGTAGGAGAGGG + Intergenic
979696997 4:123623685-123623707 ATAAGAAAAGAGAAAGGTGAAGG + Intergenic
980060937 4:128128866-128128888 CTGATGAAAGAAAAAGGGGCTGG + Intronic
980144321 4:128962513-128962535 CTGAGCCAAGAAAACAGGGATGG + Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981086545 4:140689662-140689684 GGGAGGAAGGAGAAAGGGGAGGG - Intronic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
984211010 4:176848475-176848497 TTGAACAATGAGAAAGGAGAAGG - Intergenic
986042382 5:4005979-4006001 CTCAGCAAGGAGAAAGGTGGGGG - Intergenic
986322236 5:6641362-6641384 CTGAGTAAAGCTAAAGGGAATGG + Intronic
986733917 5:10654244-10654266 CCGAGCAAAGAGGACGGGGTGGG - Intergenic
987110811 5:14684788-14684810 CCGAGCATAGATTAAGGGGAGGG - Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987493269 5:18609164-18609186 GTGAGCCAAGAAAAAGGAGAAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
987951264 5:24679778-24679800 ATGATCAAAGATAAATGGGATGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989079841 5:37606941-37606963 CTGTCAAAAAAGAAAGGGGATGG - Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989999308 5:50874514-50874536 CTGAGAACAGAAAGAGGGGAAGG - Intergenic
991604975 5:68392182-68392204 ATGAAGAGAGAGAAAGGGGAGGG + Intergenic
991970959 5:72141227-72141249 CAGAGCAAAGGCAAAAGGGAGGG - Intronic
992424608 5:76643840-76643862 GTGGGCCAAGAGGAAGGGGATGG + Intronic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
992966836 5:82011358-82011380 CTGAACAAAAAGAATGGTGATGG - Intronic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
993958753 5:94270463-94270485 CTGAGCAAAAAGAACGATGAGGG + Intronic
995062252 5:107823508-107823530 CTAAGTAAAGAGATAGGGAAAGG - Intergenic
995167337 5:109059568-109059590 CTAAGCAAAGAAATAAGGGAAGG - Intronic
995214157 5:109575415-109575437 GTGAGCAAAGAGAAAGTAGATGG - Intergenic
995319770 5:110820532-110820554 CTGAACAAAGCGGAAGGGAAGGG - Intergenic
995452708 5:112320260-112320282 GTGAGAAAAGAGGAAGGAGAAGG + Intronic
995484034 5:112620830-112620852 AGGAGGAAAGAGAGAGGGGAGGG + Intergenic
995484351 5:112624787-112624809 CTGAGCAAAAAGAACAGAGATGG + Intergenic
995538722 5:113163478-113163500 AGGAGGAAAGAGAAAGTGGATGG - Intronic
995600457 5:113790168-113790190 CCAAGCAAAGAGAATGGGGCTGG + Intergenic
995799672 5:115980251-115980273 CAAAGCACAGAGAAAAGGGAAGG + Intronic
996095815 5:119397991-119398013 CTGAGCACTGAGAAAGGATATGG + Intronic
996308623 5:122078184-122078206 CTGAGAAAGGGGAAAGGGAAGGG - Exonic
996457111 5:123697189-123697211 ATGGGCAAAGAGAAAGAGAATGG + Intergenic
996518784 5:124402942-124402964 GTGAGGATAGAAAAAGGGGAAGG - Intergenic
997020847 5:129999942-129999964 CTGAGGGAAGATAAATGGGATGG - Intronic
997121483 5:131177809-131177831 GAGAGAAAAGAGAAAAGGGAGGG - Intronic
997721675 5:136082811-136082833 CAGAGCAAAGAAAGAGGAGAGGG - Intergenic
998113517 5:139519725-139519747 ATGAGGAAAGAGAAAAGGAAGGG + Intergenic
998375648 5:141688895-141688917 CTGAGCAATGAGGGAGGGGCAGG - Intergenic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999262361 5:150245738-150245760 CTGAGGAGAGAGGCAGGGGATGG - Intronic
999389103 5:151177312-151177334 AGGAGCATAGAGAATGGGGATGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000005260 5:157177113-157177135 TTAAGCAAAGAAAAAGGGGCTGG - Intronic
1000071451 5:157744102-157744124 GTGGCCAAAGAGGAAGGGGACGG + Exonic
1000435257 5:161199983-161200005 CTGAGAAAAGAGATAGGAAATGG - Intergenic
1001012083 5:168107732-168107754 CTGAGCAAAGAGGAAGAAGCAGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002774404 6:316401-316423 CTGAGCACAGAAACAGGCGAAGG - Intronic
1003193768 6:3896870-3896892 CTGGCCAAAGAGAAAGGGACAGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003440463 6:6136654-6136676 CTGAGGAAAAAGAAATGGAATGG + Intergenic
1004106143 6:12668910-12668932 CTGGGCACAGAGACTGGGGAGGG - Intergenic
1004248994 6:14007046-14007068 GGGAGGAAAGGGAAAGGGGAGGG - Intergenic
1004517110 6:16329669-16329691 CTTTCCAATGAGAAAGGGGACGG - Intronic
1005426348 6:25706679-25706701 CTGAGCAGGGAGAAAGGAGTGGG + Intergenic
1005459440 6:26054531-26054553 CCCAAGAAAGAGAAAGGGGAGGG - Intergenic
1005600669 6:27423566-27423588 CTGAGAACAGAGAAAGGGAGGGG - Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006517097 6:34551198-34551220 CTGAGCAGAGGCAAAGGGGATGG - Intronic
1006550803 6:34821687-34821709 CTGAGCACCCTGAAAGGGGAGGG + Exonic
1006630617 6:35427487-35427509 CTGAGTAAAGGGGAAGGGGAGGG - Exonic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1007042123 6:38732394-38732416 CTTAGCAAAGAAAAAGGGGAGGG + Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007175182 6:39891511-39891533 CTCTGCCAAGAGGAAGGGGATGG + Intronic
1007589901 6:43014608-43014630 CTGAGCATAATGGAAGGGGAGGG + Intronic
1007634883 6:43293351-43293373 CTCAGAAAAGAGACAGGGGTGGG + Intergenic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007832720 6:44651128-44651150 CTGAGCATAGAGAGCTGGGAGGG - Intergenic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1008593626 6:53018777-53018799 GAGAGAAAAGAGAAAGTGGAAGG + Intronic
1010489337 6:76454667-76454689 CTGAGAAAAGAGAACTGGCAGGG - Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011038103 6:82999749-82999771 CAGAACAGAGAGGAAGGGGATGG - Intronic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012675992 6:102114419-102114441 CGGAGGGGAGAGAAAGGGGAAGG - Intergenic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1012858375 6:104529171-104529193 CTGAGCAGAGAGGATGGGGCGGG - Intergenic
1012978801 6:105808670-105808692 AAGAGCAAAGACAAAGGGAAAGG + Intergenic
1013851462 6:114521007-114521029 ATGAGTAAAGAGAAAGTGAATGG + Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1014769011 6:125440079-125440101 CTGAGCAAGGAAATAGAGGAAGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015005712 6:128278978-128279000 CTGAGCAAAGAGGCCAGGGATGG + Intronic
1015119137 6:129682298-129682320 CTTGGCAAAGAGAAAGGCGTGGG - Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017056079 6:150436496-150436518 CTGAGCAACTAGAAAGGGGCTGG - Intergenic
1017259841 6:152373119-152373141 CTGACCAAAGAGAAAGCGAAAGG - Exonic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017794743 6:157833941-157833963 CTGAGCAAGGAGACAGGAGTTGG + Intronic
1017969575 6:159299842-159299864 CTGATCATAGAGGATGGGGAAGG - Intergenic
1018524701 6:164696063-164696085 CTTAGCAAAGAGGAAGTGGGAGG - Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1020129288 7:5550483-5550505 CAGGGCAGAGAGAAAGGGGTAGG - Intronic
1020828129 7:13057916-13057938 CTGAGCAAAGTGAAAGAGAAAGG - Intergenic
1021131386 7:16916585-16916607 CTGAGCCAAGAAAAGGGAGAAGG + Intergenic
1021296722 7:18917166-18917188 CTTAGGAAAGAGCAAGGAGAAGG + Intronic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022291591 7:29009731-29009753 CAAAGAAAAAAGAAAGGGGATGG + Intronic
1022643687 7:32211597-32211619 GTAAGAAAAGAGAGAGGGGAGGG + Intronic
1022668480 7:32432730-32432752 GTGAGAAATGAGAATGGGGAGGG - Intergenic
1023242982 7:38168673-38168695 CCTGGCTAAGAGAAAGGGGATGG + Intergenic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023439429 7:40170874-40170896 TTGACCACAGAGAAAGGGGTTGG + Intronic
1023703822 7:42918613-42918635 CTGAGCAGAGAAAAAGGAAAAGG - Intronic
1023860892 7:44217252-44217274 CTCAGCAAAAAGAGAGAGGAGGG + Exonic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024665977 7:51547727-51547749 CTTGGTAAAGAGAAAGGGTAAGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1025812642 7:64884925-64884947 CTGAGCAGAGGAAAATGGGAAGG - Intronic
1026036004 7:66831127-66831149 GGGAGCAAAGGGAAAGGGGTGGG - Intergenic
1026037345 7:66839471-66839493 GGGAGCAAAGGGAAAGGGGTGGG - Intergenic
1026364359 7:69632638-69632660 TTAAGGAAAGAGAAAGGGAAAGG - Intronic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026983499 7:74540015-74540037 GGGAGCAAAGGGAAAGGGGTGGG + Intronic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1027512403 7:79098830-79098852 GAGAGGAGAGAGAAAGGGGAGGG + Intronic
1028121279 7:87059213-87059235 CCAAGCAAAGGAAAAGGGGATGG + Intronic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1028984697 7:97000544-97000566 CAGAGCAAAGGGAGAAGGGAGGG - Intergenic
1029535329 7:101154523-101154545 CTGTGCGAAGAGGGAGGGGAGGG + Intronic
1029615024 7:101650836-101650858 CTGAGCAGAGACAAAGGGTGGGG - Intergenic
1029615927 7:101657150-101657172 CTGAGCCATCAGCAAGGGGAGGG + Intergenic
1029917824 7:104230661-104230683 CTGACCAAAGAGGAGGGGGCAGG + Intergenic
1030131810 7:106207910-106207932 CAGAGCAAGGAGACAGGAGAAGG - Intergenic
1030528520 7:110682547-110682569 CTGAGAAAAGAACAAGGTGATGG + Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030875578 7:114809404-114809426 ATGAGGGAAGAGAAAGGGGTTGG + Intergenic
1031881704 7:127205800-127205822 CTGGGTGAAGAGAAAGGTGAAGG - Intronic
1031967525 7:128037764-128037786 ATGAGCCAAGAGAAGGGGGCAGG + Intronic
1031987134 7:128170489-128170511 CTGAGCACAGAGGAAGGTCATGG - Intergenic
1032564608 7:132928803-132928825 CTGAGCAAATTTAAAAGGGAGGG - Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1033478666 7:141716378-141716400 GTGAGGAAGGAGAAAAGGGAGGG - Intronic
1033651835 7:143349967-143349989 AATAGCAAAGACAAAGGGGAAGG + Intronic
1034390018 7:150778934-150778956 CTGATCCAAGAGAAAGGAGATGG - Intergenic
1035021725 7:155804528-155804550 CTGAGCAAATAGGGAGGGGGAGG - Intronic
1035287725 7:157816867-157816889 CTGAGTAAAGAGAAAAGAGGAGG - Intronic
1035426636 7:158780840-158780862 CTGAGCACAGGGAATGGTGAAGG + Intronic
1035741359 8:1930598-1930620 CAGAGCAGAGAGAACGGGGGTGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036427099 8:8654763-8654785 CTGAGAAAAGAGTAAAAGGAAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036800278 8:11786003-11786025 CTGAACCGAGAGAAAGGGGATGG - Exonic
1037571774 8:20164192-20164214 CTGAGGAAAGAGGACAGGGAAGG - Intronic
1037643387 8:20769179-20769201 GTGAGAAGAGAGAAAGAGGAAGG + Intergenic
1038207454 8:25480568-25480590 ATGAGGAAAGAGAAAGTTGATGG + Intronic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1040364022 8:46695569-46695591 TAGAGTAAAGAGGAAGGGGATGG + Intergenic
1040538504 8:48330502-48330524 GGCAGCATAGAGAAAGGGGATGG - Intergenic
1040587845 8:48760892-48760914 CTAAGCACAGAGAAAGCAGAGGG - Intergenic
1040956135 8:52981983-52982005 CTGAGCAAAGAGAAAAATGGAGG - Intergenic
1041473617 8:58238593-58238615 CTGAACAAAGAGAAAGAAAATGG + Intergenic
1041617002 8:59918905-59918927 CTCAGCTAATAGAAAGGGGATGG - Intergenic
1041712863 8:60909769-60909791 CGGAGGAAAGACAAAGGGCAAGG + Intergenic
1041863247 8:62538053-62538075 CTGAACACAGGGAAAGGGAAAGG + Intronic
1042599593 8:70485436-70485458 TGGAGCAATGAGAAATGGGAGGG + Intergenic
1042640202 8:70925717-70925739 GTAAGCTAAGAGAAAGGAGAAGG + Intergenic
1042681437 8:71389867-71389889 CTGAACAAAGGGAAAGGGATAGG - Intergenic
1042816904 8:72887826-72887848 CTGGGCAGAGAGAAAGTGTAGGG - Intronic
1043854194 8:85245772-85245794 CTGAGCAGCGAGAAAGAGGAGGG - Exonic
1044315420 8:90745020-90745042 CTAAGCAAAAAGAAAGAGGCTGG - Intronic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044722040 8:95160180-95160202 CTCAGCAGAGGGAATGGGGAGGG - Intergenic
1045076015 8:98569111-98569133 CTGAGCAAGGAAAAAGAGCAAGG + Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1045714089 8:105021276-105021298 CTCAGAAAAGAGAAAAGGAATGG + Intronic
1045748602 8:105454753-105454775 CTGTTCATAAAGAAAGGGGAGGG + Intronic
1045789474 8:105965434-105965456 CTGAGCAAAGGGAGAGATGAAGG - Intergenic
1046248983 8:111605101-111605123 CTGAGGAAAGAGAAAAGAGGTGG - Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047063966 8:121260027-121260049 CTGAGCAAGAAAAAAAGGGAAGG - Intergenic
1047169592 8:122478803-122478825 CTGAGAGAGGAGTAAGGGGAAGG + Intergenic
1047410663 8:124621843-124621865 CTGGGGAAAGAGATAGGGGCTGG - Intronic
1047663940 8:127069086-127069108 CTGAGCAGAGAGAAAGAGATGGG - Intergenic
1048027769 8:130602276-130602298 CTGAGGAAAATGGAAGGGGATGG - Intergenic
1049887510 9:37708-37730 CTGAGTAAAGTTGAAGGGGAGGG + Intergenic
1050051646 9:1608307-1608329 GTGAGGATTGAGAAAGGGGAGGG + Intergenic
1051010701 9:12409973-12409995 CTAAACAAAGAAAAATGGGAAGG - Intergenic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1051585938 9:18726902-18726924 CTGAGAAAAGAGACTGGGGCTGG - Intronic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052467174 9:28843599-28843621 CAGTGAACAGAGAAAGGGGAGGG + Intergenic
1052889584 9:33685930-33685952 CTGAGCACTGGGAAAGGGGTGGG + Intergenic
1053158231 9:35794654-35794676 CTGAGCAAAGAGAAAAAGATAGG + Intronic
1054734943 9:68741663-68741685 CTAAGCAAAGAGATAGAGAAGGG + Intronic
1055112814 9:72576380-72576402 GTCAGAAAGGAGAAAGGGGAGGG - Intronic
1056164135 9:83925316-83925338 CTGAGAAAAAAAAAGGGGGAGGG + Intergenic
1056339211 9:85608131-85608153 ATGAGCAAAGATATAGAGGATGG + Intronic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057077605 9:92146967-92146989 CTCTGTAAAGAGAAATGGGAGGG - Intergenic
1057374794 9:94510773-94510795 CGGAGCAAACAGAAAGCAGATGG + Intergenic
1057414166 9:94846603-94846625 CTGGGCAAAGAGAAAGAAGCTGG + Intronic
1057450545 9:95155229-95155251 GAGAGAAAAGAGAGAGGGGAGGG + Intronic
1057605362 9:96494837-96494859 CCGACAAAAAAGAAAGGGGAGGG - Intronic
1057842395 9:98496517-98496539 GTCAGCAAAGAGAAAGCAGAGGG + Intronic
1058816306 9:108685706-108685728 CTGACTGAAGAGAAAAGGGAAGG + Intergenic
1059064686 9:111070575-111070597 CTAAGAAAAGAAAAAGGGAAGGG + Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1059976442 9:119722885-119722907 CTGAGAGAAGAGAAAGAGGGAGG - Intergenic
1060016179 9:120088273-120088295 CTGAGGATGGAGAAAAGGGAAGG + Intergenic
1060187234 9:121571079-121571101 CTCAGGGAAGAGAAAGAGGAAGG - Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1060892597 9:127198278-127198300 CTGAGCACTGGGAAAGGGGGAGG - Intronic
1061059436 9:128243266-128243288 GTGACCAGAGAGAATGGGGAGGG + Intronic
1061445129 9:130633326-130633348 GCGAGCAGAGGGAAAGGGGATGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061761465 9:132854808-132854830 CAGTGCCAAGATAAAGGGGAGGG - Intronic
1061998997 9:134206655-134206677 TAGAGCAGAGAGGAAGGGGAGGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062510939 9:136905655-136905677 CTGGGAACAGAGAAAGGGAATGG - Intronic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186225324 X:7393064-7393086 CTGGGAAAAGAGGAAGGGAAAGG - Intergenic
1187636875 X:21238698-21238720 CTTTGCCTAGAGAAAGGGGAAGG + Intergenic
1187707088 X:22019678-22019700 ATGTGAAAAGAGAAAGGGGATGG + Intergenic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1189245078 X:39557194-39557216 GTGAGCAAAGAAAGAGGTGAGGG - Intergenic
1189470653 X:41311400-41311422 GTGAGCAGAGAGAATGGTGAAGG + Intergenic
1189824670 X:44905953-44905975 CTGAGCAAAGTAAAAGAGAATGG - Intronic
1189856862 X:45232367-45232389 CTTATGAAAGATAAAGGGGAAGG - Intergenic
1190617543 X:52251218-52251240 CTGAGGAAAGAGACAAGGGTGGG - Intergenic
1191771509 X:64764765-64764787 CTGAGAAAAGAACAAGGAGAAGG + Intergenic
1191911323 X:66153441-66153463 CTGAACAAAGAATAAGGAGATGG + Intergenic
1191966082 X:66759988-66760010 CTAAGATCAGAGAAAGGGGAAGG - Intergenic
1193562539 X:83037132-83037154 CTGAGCAAAAAGAAAAGAGCTGG + Intergenic
1194663486 X:96652044-96652066 GTGAGCAAGGAAAAAGGGGCTGG - Intergenic
1195001444 X:100647076-100647098 GTGAGAAGAGGGAAAGGGGAGGG + Intronic
1195134197 X:101887444-101887466 CTGGTCAAAGATAAAGTGGAAGG - Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196124169 X:112082037-112082059 ATGAGCACAGGGAAAGGGGCGGG + Exonic
1196823723 X:119724427-119724449 GTGAGGAAATAGAAAGGGCAGGG + Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197261021 X:124318184-124318206 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1198069585 X:133134846-133134868 AGGAGAAAAGAGAATGGGGAGGG + Intergenic
1198810718 X:140533672-140533694 GTCAGCACAGAGAAAGGGAATGG - Intergenic
1199086766 X:143636318-143636340 CTGTGAAGAGAGAAAGGGAAGGG + Intergenic
1199284580 X:146041958-146041980 GAGAGAAAAGAGAAAGGGAAGGG + Intergenic
1199531529 X:148853291-148853313 TGGAGCAAGGAGACAGGGGAGGG + Intronic
1199744275 X:150761967-150761989 CTGAGCAAGGAGGGAGGGGTTGG + Intronic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201236594 Y:11917850-11917872 CAGAGCAAAAGGAAAGGAGAAGG + Intergenic
1201686539 Y:16710755-16710777 CTAAGCCAAGAGAGATGGGAAGG + Intergenic