ID: 1076030652

View in Genome Browser
Species Human (GRCh38)
Location 10:127155064-127155086
Sequence GTTTATAAGCTAATGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076030652 Original CRISPR GTTTATAAGCTAATGCAGAT GGG (reversed) Intronic
904954237 1:34269691-34269713 GTCTATAAACTAAGGCAGAAGGG + Intergenic
906947098 1:50304062-50304084 GTTTATAGGCTAATGAAGGAGGG + Intergenic
907013309 1:50985930-50985952 GTTTATAATTTAATGAAGTTAGG + Intergenic
908965070 1:69750942-69750964 CTTAATATGCTAATGCATATGGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910609886 1:89129387-89129409 GTTTAGAAACTAGTGCAGAAGGG - Intronic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
1066710183 10:38224715-38224737 GTATATAAGTTAAAGCAGCTGGG - Intergenic
1067407998 10:46040564-46040586 GCTTATAAGTTAAAGCAGAGGGG - Intronic
1068153471 10:53164997-53165019 ATTCATAAGCTAATGGATATAGG + Intergenic
1071376255 10:85007692-85007714 GATTGGAAGCCAATGCAGATAGG + Intergenic
1076030652 10:127155064-127155086 GTTTATAAGCTAATGCAGATGGG - Intronic
1077651840 11:3979788-3979810 GTTTATAAGACAAAGAAGATTGG - Intronic
1078143698 11:8709126-8709148 GCTGCTAAGCAAATGCAGATGGG + Intronic
1079049797 11:17144179-17144201 GTATATAAACAAAAGCAGATAGG - Intronic
1079484379 11:20919671-20919693 TCTTATAAGCTAATGCATTTTGG + Intronic
1079914709 11:26354115-26354137 GATTAGAGGCTTATGCAGATTGG + Intronic
1081102465 11:39022406-39022428 GTTTTTAAAGCAATGCAGATTGG + Intergenic
1084850649 11:71937032-71937054 GTTTATAAACAAATACTGATAGG - Intronic
1094242095 12:28240494-28240516 GTTATGAAGCTAAGGCAGATAGG + Intronic
1096904379 12:54920536-54920558 GTTTATCATATTATGCAGATAGG - Intergenic
1099087933 12:78269744-78269766 GTTTCTAAGCTAGTGTAGTTGGG - Intergenic
1099233601 12:80055930-80055952 GTTTCCAAGGTAATGCTGATAGG - Intergenic
1104032341 12:125074072-125074094 TTTTACAACCTCATGCAGATGGG + Intronic
1105671150 13:22617763-22617785 GGATGTATGCTAATGCAGATGGG + Intergenic
1107139804 13:36985925-36985947 GTTTTTAAAATAATGAAGATAGG - Intronic
1108483529 13:50900988-50901010 ATTGATGAGCTAATTCAGATTGG + Intergenic
1109991477 13:70063770-70063792 GTTTACAAGCTACTGCACAATGG + Intronic
1111800644 13:92975535-92975557 GTTTATCAGCAAATGCATCTAGG + Intergenic
1112225028 13:97531454-97531476 GTTCATAAGCTAAGGCATTTGGG + Intergenic
1114517211 14:23307822-23307844 GGTTATAAGCTGAGGCAGAAGGG + Exonic
1115901919 14:38161358-38161380 GTTTTTAAGCTACCACAGATGGG - Intergenic
1115975668 14:38993810-38993832 GTTTTTACGCCAATGAAGATAGG - Intergenic
1120441131 14:84541396-84541418 TATTAAAAGCTAAAGCAGATGGG - Intergenic
1120509691 14:85398376-85398398 GCTTATAACCTAATACAGAAGGG - Intergenic
1121379579 14:93451450-93451472 GTGTAAATGCTAATGCAGAGCGG - Intronic
1129536969 15:76321492-76321514 GTTTGGAAGCTGATGGAGATCGG + Intergenic
1129557049 15:76521485-76521507 GTTTATTAACTAATGAAAATTGG - Intronic
1135899998 16:26448728-26448750 GCTTATAAGCCAATGCAATTAGG - Intergenic
1137313466 16:47290019-47290041 GTTTTGAAGCAAATGAAGATAGG - Intronic
1146501197 17:33365972-33365994 GTTGGTAAGCTAAGGCAGGTTGG + Intronic
1155692667 18:28645546-28645568 GTTTATAAACAATTTCAGATGGG - Intergenic
1156435646 18:37125689-37125711 GTTAATAAGGAAATACAGATTGG + Intronic
1156977773 18:43245555-43245577 GTTTATAGGATAAAACAGATTGG - Intergenic
1159915502 18:74183973-74183995 GTTTAAAAATTAAAGCAGATAGG - Intergenic
1161753877 19:6117277-6117299 CTTTATGAGCTAATGCTGCTAGG - Intronic
926173845 2:10571592-10571614 GTTTATAAGTTTATGCTGATAGG - Intronic
927649037 2:24899719-24899741 TTATATAAGCTTATGCAAATCGG - Intronic
927889528 2:26739592-26739614 GTTTTGAAGCTGGTGCAGATAGG - Intergenic
929005548 2:37389704-37389726 GTTTATACAATAATGAAGATTGG + Intergenic
939109565 2:137991326-137991348 GGTTATAATCTAATGCTGATAGG + Intronic
939865796 2:147471090-147471112 GATAATAAGCTAATGTATATGGG + Intergenic
943114601 2:183651230-183651252 GTTTCTAAGCCAATGAAGAATGG + Intergenic
943588590 2:189769467-189769489 CTCTATAAGCTAATTCATATAGG + Intergenic
1168928202 20:1599826-1599848 TTTTATAAGGTAATGGGGATGGG - Intronic
1176388567 21:6151801-6151823 TTTTATAAACTAAGGCAGAGCGG + Intergenic
1179734905 21:43386447-43386469 TTTTATAAACTAAGGCAGAGCGG - Intergenic
949589792 3:5482397-5482419 GTTTATAAGCTAGTGCTCTTGGG + Intergenic
950816759 3:15712043-15712065 TTTTAAAAATTAATGCAGATGGG - Intronic
950918453 3:16668626-16668648 TTTTATTTGCTAATGCAGGTAGG - Intronic
958635142 3:96734305-96734327 GTTTATAAGCTATTGAAGTGAGG - Intergenic
958728761 3:97937572-97937594 TTTTATGATCTAATGTAGATTGG - Intronic
959551369 3:107662762-107662784 GTTTAAAAGCTAGTACAGCTGGG - Intronic
960422132 3:117459903-117459925 GTATATAAGATGATGCAGAAAGG - Intergenic
960917956 3:122716358-122716380 ATTCCTAAGCTAATGAAGATCGG - Intronic
961685034 3:128624176-128624198 TTTTATAATCAAATGCAGATAGG - Intronic
964861136 3:161202527-161202549 GTTTATAGGATAATGCATCTTGG - Intronic
970091144 4:12409569-12409591 TTTAATATGCTAATTCAGATGGG + Intergenic
971629808 4:28976111-28976133 GTTAATAGGCTATTGCTGATAGG - Intergenic
971791588 4:31176685-31176707 GTTTCTAAGCTCATGAAGCTAGG + Intergenic
971892030 4:32537197-32537219 GTGTATAAGCTACTGGAGACTGG - Intergenic
973865595 4:55109661-55109683 TTTTATATGCTAATGTATATTGG - Intronic
974085980 4:57262002-57262024 GCTTATAAGCCAAAGGAGATTGG - Intergenic
975169898 4:71221740-71221762 ATTAACAAGTTAATGCAGATTGG + Intronic
978113429 4:104990574-104990596 TTTTATAAACTAATCTAGATTGG + Intergenic
979731950 4:124034693-124034715 ATTTATAAACTCATGCAAATTGG - Intergenic
980125601 4:128771084-128771106 GTATATAACCAAAAGCAGATTGG + Intergenic
980611059 4:135164347-135164369 GTAAATGAGCTAAAGCAGATTGG - Intergenic
982321284 4:154079839-154079861 CTTTATAAGCTTCTGCAGTTTGG - Intergenic
983092636 4:163522979-163523001 GTTAAGAAGCTACTGCACATAGG - Intergenic
983719303 4:170827323-170827345 ATTTTTAAGCTAAGGCAGTTAGG + Intergenic
984213527 4:176879830-176879852 ATTAATAAGCTAATGCTAATAGG - Intergenic
984227925 4:177057515-177057537 GGTTATAAGCAAAAACAGATTGG - Intergenic
987866610 5:23548575-23548597 GTTTATATGATAAAGCAAATTGG + Intergenic
988925475 5:35986599-35986621 TTTTGTAAGCTACTGCATATGGG - Intronic
989756669 5:44963411-44963433 TTTTATAAGCTAAGGGAGAGGGG - Intergenic
991706969 5:69367843-69367865 CTTTATAAGTTAAAGCAAATAGG - Intronic
992334984 5:75757592-75757614 GATTATAAGCTAATACATTTGGG - Intergenic
992661486 5:78966185-78966207 ATTTAAAAGATAATACAGATAGG + Intronic
993746258 5:91601041-91601063 CTTTTTTAGTTAATGCAGATAGG + Intergenic
994658591 5:102626098-102626120 GTTTACGAGCTTATACAGATGGG + Intergenic
996157266 5:120116925-120116947 CTTTTTAAGCATATGCAGATAGG + Intergenic
1002370538 5:178749544-178749566 AGTAATAAGCTAAAGCAGATTGG + Intergenic
1003289392 6:4766586-4766608 CTTTATAAGCAAATGCATACAGG + Intronic
1003628935 6:7769090-7769112 GTTAATATGCTACTGCAGGTAGG + Intronic
1007691392 6:43703779-43703801 TTATATGAGCTAATGCAGAAAGG + Intergenic
1008819692 6:55616072-55616094 TTTTATAATCTACTGCAGAATGG - Intergenic
1010082049 6:71874904-71874926 GTTTAAAAAATAATGCAAATGGG - Intergenic
1011648964 6:89488239-89488261 GTTTATAATCAAATGCAGGTGGG - Intronic
1012861737 6:104568327-104568349 GTTCATCAGCTAATTCAGTTTGG + Intergenic
1015001825 6:128226666-128226688 GTTTATGTGCTTGTGCAGATTGG - Intronic
1020499980 7:8905562-8905584 GTTTATAAATTAATACATATAGG - Intergenic
1022835261 7:34107347-34107369 GTTAATAAGCTCATCCAAATTGG - Intronic
1023989578 7:45120347-45120369 GTTTATAAGCATATGAATATAGG + Intergenic
1026449131 7:70511969-70511991 ATTTATAAGCTCATGAAGTTGGG - Intronic
1030064380 7:105648201-105648223 GTTCATTAGCTAATGGAGAAGGG + Intronic
1030773421 7:113503313-113503335 ATTTATAATCTAATTCAGTTTGG + Intergenic
1032264064 7:130358433-130358455 GTTTTAGAGCTAAAGCAGATTGG - Intronic
1033011171 7:137624545-137624567 GTATATAAAGTACTGCAGATGGG - Intronic
1033379431 7:140799507-140799529 GTTTAGAAGCTAGTGAAGAAAGG - Intronic
1034847016 7:154455760-154455782 GACTATAAGCTAAGGCAAATGGG + Intronic
1036207617 8:6816509-6816531 GTTAATAAGCTGACCCAGATGGG - Intronic
1037033044 8:14133055-14133077 GTTTCTCAGTTATTGCAGATTGG + Intronic
1038349768 8:26765296-26765318 GTGAATGAGCTAATGCTGATGGG + Intronic
1044340577 8:91041789-91041811 TTTTATAAGGAAGTGCAGATGGG - Intergenic
1046925682 8:119785673-119785695 TTTTATTAGCTAATTCATATAGG - Intronic
1049833345 8:144716447-144716469 GTTTATAAATTAATGAAGACTGG + Intergenic
1186562546 X:10628409-10628431 ATTTATAAGATAATGTAGACAGG - Intronic
1186702353 X:12105398-12105420 GTGTCTGAGATAATGCAGATTGG - Intergenic
1186730575 X:12405200-12405222 GTTCATAAGGTAAGGTAGATAGG + Intronic
1187731621 X:22261004-22261026 CTTTGTAAGGTAATGTAGATGGG + Intergenic