ID: 1076031070

View in Genome Browser
Species Human (GRCh38)
Location 10:127159011-127159033
Sequence GAACACTCCTTGGTCAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076031064_1076031070 6 Left 1076031064 10:127158982-127159004 CCTGGACCTCTCCTTGCTTGATG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data
1076031059_1076031070 27 Left 1076031059 10:127158961-127158983 CCCAGGGACCAATTTGGGGACCC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data
1076031063_1076031070 7 Left 1076031063 10:127158981-127159003 CCCTGGACCTCTCCTTGCTTGAT 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data
1076031062_1076031070 19 Left 1076031062 10:127158969-127158991 CCAATTTGGGGACCCTGGACCTC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data
1076031066_1076031070 -5 Left 1076031066 10:127158993-127159015 CCTTGCTTGATGCCTTTTGAACA 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data
1076031060_1076031070 26 Left 1076031060 10:127158962-127158984 CCAGGGACCAATTTGGGGACCCT 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data
1076031065_1076031070 0 Left 1076031065 10:127158988-127159010 CCTCTCCTTGCTTGATGCCTTTT 0: 1
1: 0
2: 0
3: 39
4: 368
Right 1076031070 10:127159011-127159033 GAACACTCCTTGGTCAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076031070 Original CRISPR GAACACTCCTTGGTCAAGGT AGG Intronic
No off target data available for this crispr