ID: 1076032669

View in Genome Browser
Species Human (GRCh38)
Location 10:127172765-127172787
Sequence CCTTAAATCAAGACAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076032669_1076032677 26 Left 1076032669 10:127172765-127172787 CCATCCTTTGTCTTGATTTAAGG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1076032677 10:127172814-127172836 CCAGGCACTGTGCCATGTTCTGG No data
1076032669_1076032674 8 Left 1076032669 10:127172765-127172787 CCATCCTTTGTCTTGATTTAAGG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1076032674 10:127172796-127172818 TCCTCAGATGCTTAAGAACCAGG No data
1076032669_1076032678 27 Left 1076032669 10:127172765-127172787 CCATCCTTTGTCTTGATTTAAGG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1076032678 10:127172815-127172837 CAGGCACTGTGCCATGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076032669 Original CRISPR CCTTAAATCAAGACAAAGGA TGG (reversed) Intronic
900490099 1:2943824-2943846 CTTTAAATCAGTACAGAGGAGGG - Intergenic
901534637 1:9874235-9874257 CTTTACACCAAGACAAAGGATGG - Intronic
901692336 1:10981672-10981694 CCTTAAAACAAAACAAATTAGGG - Intronic
901936276 1:12629414-12629436 GATTCAACCAAGACAAAGGAAGG + Intergenic
903926269 1:26832957-26832979 AATTAAATCAAGGCAAAAGAGGG + Intronic
904103099 1:28050713-28050735 GCTCAAATCAAGACAAACAATGG - Intronic
904231617 1:29078864-29078886 CCTTAAAACAAACCAAATGAAGG - Intronic
906092376 1:43191767-43191789 ACCTAAAGCAAGCCAAAGGAAGG - Intronic
913138959 1:115921480-115921502 GCTTAAAACAAGAGAAAGAAAGG - Intergenic
915185763 1:154103965-154103987 AAATAAATAAAGACAAAGGAAGG + Intronic
917828108 1:178845481-178845503 CCTTAAACCAAGACAAATAGGGG - Intronic
918312845 1:183298128-183298150 CCTAAAATGAAGAACAAGGAAGG + Intronic
918762973 1:188437862-188437884 CCTTAAAGATAGACAAAGTAAGG - Intergenic
919520409 1:198581439-198581461 TCTAAAGTCAAGACAAAGGAAGG - Intergenic
920528789 1:206686350-206686372 CCTTAAAGAAAGAAAAGGGATGG - Intronic
920877856 1:209854182-209854204 TCTGAAATATAGACAAAGGATGG + Exonic
921752659 1:218815125-218815147 GCTGAAAGCAATACAAAGGAAGG + Intergenic
922932639 1:229402419-229402441 CCCTAAATAAATAAAAAGGAAGG - Intergenic
923338195 1:232987534-232987556 CATTAAATAAAGACAAACAAGGG + Intronic
923966931 1:239152147-239152169 ACATAATTCAAGTCAAAGGAAGG + Intergenic
924509996 1:244722393-244722415 CCTAAAAACAAAACAAAGGGCGG - Intergenic
924859716 1:247908598-247908620 CCCTAAATCTGGACAAGGGAAGG + Intergenic
1064049183 10:12045116-12045138 CCTAAAATCAAAAAACAGGAGGG + Intergenic
1064910140 10:20392313-20392335 CCATTACTCAAGACAATGGATGG - Intergenic
1065578130 10:27144362-27144384 ACTGAAATAAAGGCAAAGGAAGG + Intronic
1067131689 10:43571000-43571022 TGTTAAAGCAAGACAAAGGTGGG + Intronic
1067271104 10:44791946-44791968 TCTTAAACCAGGCCAAAGGATGG + Intergenic
1068968643 10:62939337-62939359 CCAAAAATCCAGACAGAGGATGG - Intergenic
1069302551 10:66926565-66926587 CCTTTGAACAATACAAAGGATGG + Exonic
1071437157 10:85657982-85658004 CCACAAATCAAGACAAAAGCAGG + Intronic
1076032669 10:127172765-127172787 CCTTAAATCAAGACAAAGGATGG - Intronic
1077901441 11:6492850-6492872 CCTTGAAACAAGAAAAAGGTGGG - Intronic
1078421982 11:11219947-11219969 CCTTTAATTAAGACACAAGATGG - Intergenic
1079153663 11:17924335-17924357 TCTAAAATCAGGCCAAAGGAAGG + Intronic
1079393247 11:20040270-20040292 CCATAATGCAAGACAAAGGCAGG + Intronic
1080078166 11:28177344-28177366 CCTGAAATCAAGAAAAATGCTGG + Intronic
1080411816 11:32032120-32032142 GATTAAAGCAAGACAGAGGATGG - Intronic
1082691065 11:56305822-56305844 CATTAAAAAAAGACAAAGAAGGG - Intergenic
1085709325 11:78814801-78814823 CTTTATATCAAAACAAAGTATGG - Intronic
1086920711 11:92583325-92583347 CCTTAACCCAACAGAAAGGAGGG - Intronic
1087080372 11:94165129-94165151 TCTTCAATCAAGAGAAAGAATGG - Intronic
1087472375 11:98592936-98592958 CAATAAATCAAGAAAAACGAGGG + Intergenic
1087536349 11:99451148-99451170 CTTAAAGTCAAGAGAAAGGATGG + Intronic
1090628722 11:128627755-128627777 CCTCCAATAAGGACAAAGGAGGG - Intergenic
1090815315 11:130288954-130288976 ACTTAAAACAAGACTAAGCAAGG + Intronic
1091652486 12:2320250-2320272 CCTGGAATAAAGTCAAAGGAGGG - Intronic
1093134198 12:15430419-15430441 CCTTAAGTCAAGGAAGAGGAGGG + Intronic
1094169403 12:27476614-27476636 CTATAAAAAAAGACAAAGGAGGG - Intronic
1095262297 12:40110561-40110583 CCTTACAGCAAGTCAAAGAAAGG - Intergenic
1096037023 12:48481526-48481548 TCTAAAATCAAAACAAGGGATGG + Intergenic
1098738427 12:74137906-74137928 CTTTATATCAAGACAAAGCTGGG - Intergenic
1099413072 12:82355896-82355918 GTTTAAATCATGAGAAAGGAAGG - Intronic
1101278981 12:103230902-103230924 GCTTAAATCTAGAAAAAGAAAGG - Intergenic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1103528574 12:121583688-121583710 CCTTAAATTAAAACAAAACAGGG - Intergenic
1104680193 12:130745223-130745245 CCTGACATCAAGACATAGAATGG - Intergenic
1106575241 13:30968372-30968394 TCTTAGATCCAGACAAGGGAAGG + Intronic
1106994951 13:35470788-35470810 CCTCCAATAAACACAAAGGAGGG + Intronic
1107299677 13:38952029-38952051 CCTTAAACCACGAAAAAAGAGGG - Intergenic
1107810169 13:44192980-44193002 ACTTAAATAAAGATAAAAGATGG - Intergenic
1108750391 13:53442070-53442092 CATTAAATCAATAGAAATGAAGG - Intergenic
1109159499 13:58954888-58954910 CCCTAAATCCAGACAAAGACGGG - Intergenic
1110136253 13:72070964-72070986 CCTTCAATTAATCCAAAGGATGG - Intergenic
1110420186 13:75298839-75298861 TCTTACATGAAGATAAAGGAGGG + Intronic
1112356681 13:98679370-98679392 CCTTATAACAAAACTAAGGAAGG - Intergenic
1114539759 14:23446310-23446332 CTTGAAATCAAGAGAATGGAGGG + Intergenic
1114595946 14:23911682-23911704 CCTTTATTCAAGAAAAAGCATGG + Intergenic
1115014632 14:28595139-28595161 CCTTACATCAAAACAAGGGGTGG + Intergenic
1115150868 14:30283856-30283878 CTAGAAATCAAGAAAAAGGAAGG - Intergenic
1115228703 14:31134039-31134061 CCTTAAAAAAAAAAAAAGGATGG + Intronic
1115648482 14:35386144-35386166 CCTCAAAGCAAAACAAAGCAGGG - Intergenic
1115873688 14:37836611-37836633 CAGTATATCAAGTCAAAGGATGG - Intronic
1116135435 14:40917247-40917269 CCTGAAATGAATAAAAAGGAAGG - Intergenic
1118094297 14:62519207-62519229 ACATAAAGCAAGACAAAGAAGGG + Intergenic
1119059468 14:71460524-71460546 CTTTAAGTCAAGACTAAGAAGGG - Intronic
1121885936 14:97542692-97542714 CCTTAAAGTAAGGCAAATGAGGG - Intergenic
1122168967 14:99854927-99854949 CCGTAAATACAGACAAATGATGG + Intronic
1124545237 15:30620700-30620722 CCATATCTCAAGACAACGGAAGG - Intergenic
1124778763 15:32610092-32610114 CCATATCTCAAGACAACGGAAGG - Intergenic
1124958523 15:34376575-34376597 CCTGGAATCAGTACAAAGGAAGG - Intergenic
1125237117 15:37528361-37528383 TCTTAGATCAAGAAAATGGATGG - Intergenic
1126606120 15:50478322-50478344 CTTTAAATAAAGCCAAATGAAGG - Intronic
1127793706 15:62420720-62420742 CCTTAAAGCATGACAAAATAAGG + Intronic
1127839268 15:62816649-62816671 CCTAAGCTCAAGACAAGGGAAGG - Intronic
1130529046 15:84731856-84731878 CCTTAATTCAAGAGAATGGAGGG - Intergenic
1130832309 15:87613867-87613889 GCTTAAACCAAGTCAAAAGAAGG - Intergenic
1132152681 15:99473827-99473849 CATTTAACCAAGACAAAGGAGGG + Intergenic
1135820732 16:25683218-25683240 CCTTACAAGAAGACAAAGGCAGG + Intergenic
1135947291 16:26876399-26876421 CCCTAAATGGAGACACAGGAAGG + Intergenic
1139792482 16:69450726-69450748 CCATGAACCAAGAGAAAGGAAGG - Intronic
1144904312 17:18627673-18627695 ACATAAATTAAGACAAAGGCTGG - Intergenic
1148554257 17:48568707-48568729 CTATAAATCAAGAAAAAGGTTGG + Intronic
1150678135 17:67262487-67262509 CCTTTGGTCAAGACAATGGAAGG - Intergenic
1150770492 17:68036574-68036596 AGTTAATTCAAGACAAAGTAGGG - Intronic
1151387012 17:73761149-73761171 CCTTAAGTCCAGTCACAGGAGGG + Intergenic
1154233851 18:12584050-12584072 GCTTAAAGCAAGACACAGAAAGG + Intronic
1154983081 18:21520587-21520609 CCTGAAATAGAGAAAAAGGAAGG + Intronic
1156068353 18:33173725-33173747 CATCAATGCAAGACAAAGGAAGG - Intronic
1157726539 18:49968683-49968705 CCTTAAAGCATGACAAAATAAGG - Intronic
1157818467 18:50748414-50748436 CCTTAAATAAAGGCAGAGGGAGG + Intergenic
1160018536 18:75162898-75162920 CCTCACAACCAGACAAAGGAAGG + Intergenic
1161477568 19:4494916-4494938 TCTCAAAACAAAACAAAGGAGGG + Intronic
1165048603 19:33126518-33126540 CCTTAATTCAATACAATGAAAGG - Intronic
1165141388 19:33702280-33702302 CCTTAAAACAAAACATAGGCCGG - Intronic
1165575378 19:36811564-36811586 TCTTAAATCAAATTAAAGGAGGG - Intergenic
1165817863 19:38653679-38653701 ACATAAATGAAGGCAAAGGAAGG - Intronic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1166786243 19:45369029-45369051 CCGTAAAGGCAGACAAAGGAAGG - Intronic
1167107295 19:47437741-47437763 CCTAAGATCAAGCCAAAGAAGGG - Intronic
1167224978 19:48231957-48231979 CTTTGAATCCAGACAAAGAAAGG + Intronic
1167521354 19:49958019-49958041 CATTAAATAAAGACAAAGAAGGG - Intronic
924972647 2:143157-143179 CCTTAAAGCATGACAAAATAAGG - Intergenic
925403965 2:3593598-3593620 CCTGAGATCAAGACAAGGCAAGG - Intergenic
925519864 2:4731530-4731552 AATTTAAACAAGACAAAGGAAGG - Intergenic
926307764 2:11651498-11651520 CCCTAAATGAAGAAATAGGAGGG - Intergenic
927478592 2:23433054-23433076 CCCTTTATCAAGACAACGGAGGG - Intronic
927493447 2:23536142-23536164 CCTTTTGTCAAGACAAAGGTGGG + Intronic
927663389 2:25011935-25011957 CCTTACATCAAAACAAGAGAAGG - Intergenic
930489419 2:52049547-52049569 CAGTGAATCAATACAAAGGAAGG + Intergenic
930506475 2:52287821-52287843 CCTTAAAGCATGACAAAATAAGG - Intergenic
930877246 2:56232856-56232878 CGTTATATAAAGACAAAAGAGGG - Intronic
931391226 2:61845786-61845808 CCTTGTATCAAGAAAAAAGAAGG + Intronic
933893586 2:86791236-86791258 CCTTTAGTGAAGGCAAAGGAAGG - Intronic
934675375 2:96246199-96246221 CCTGAAATCAACCCAAAGGGTGG - Intergenic
935143216 2:100374365-100374387 CCTAAAATCAGGAACAAGGAAGG + Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
938646477 2:133336069-133336091 CCTTCAATCAGGACAGAGGGTGG + Intronic
942647856 2:178133974-178133996 CCTTAAATAAAGTCAAAGCATGG - Intronic
943588596 2:189769551-189769573 CCATAAACCTAGAAAAAGGATGG + Intergenic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
944916454 2:204365433-204365455 CCTTAAAACAGGCCAGAGGAGGG - Intergenic
945272778 2:207958546-207958568 CCTTGAAACAAGACAAATGCTGG + Intronic
945688995 2:213009147-213009169 GCTTCAATCAAGAAAAAGTATGG - Intronic
945916811 2:215712966-215712988 CCTGTAAGCAAGAAAAAGGAAGG - Intergenic
946016451 2:216607934-216607956 CCGTGAGTCAAGACAGAGGATGG - Intergenic
947710360 2:232310227-232310249 CTTGAAATCAAGAGAGAGGAGGG + Intronic
948110728 2:235453510-235453532 CCGTAAGTAAAGACAAAAGATGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171041139 20:21764579-21764601 CCTAAAATCAAGACATTTGACGG - Intergenic
1171114346 20:22511769-22511791 TCTTAAAAAAAGACAAATGAGGG + Intergenic
1171539054 20:25929827-25929849 CCAAAAATCTAGCCAAAGGATGG - Intergenic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1172307998 20:33895366-33895388 CCTTAAATGAAGACACAGGGTGG + Intergenic
1172983889 20:38966956-38966978 CCTTTCAACAAGACAAAAGATGG - Intronic
1174903947 20:54530407-54530429 CCGTAGATCAAGACAAGGGTAGG - Intronic
1176053002 20:63130373-63130395 CCTTAACACAAGACAATGAAAGG - Intergenic
1177187591 21:17815097-17815119 TATAAAATGAAGACAAAGGAAGG - Intronic
1178011009 21:28287163-28287185 CCTGTAATCAAGAGGAAGGAGGG + Intergenic
1178676153 21:34633477-34633499 CCTTAAAAGATGACAAAAGAAGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1180660992 22:17467078-17467100 CCTTTAATCTAGACAGCGGAAGG - Intronic
1181866444 22:25860375-25860397 ACTCAAATCAAGTGAAAGGAAGG - Intronic
1182814142 22:33143978-33144000 AATTAAATCAAGATAAAGAAAGG - Intergenic
949685274 3:6562636-6562658 CGTTAACTCAAGAAAAATGAAGG - Intergenic
950350594 3:12347376-12347398 CCATAAAAGCAGACAAAGGAAGG - Intronic
950490745 3:13303457-13303479 CCTCAAATCAACCCAAACGATGG + Intergenic
953594118 3:44291664-44291686 ACTTACACCAAGAAAAAGGAAGG + Intronic
953797717 3:45997989-45998011 CCTTAAAGCAGGTGAAAGGAGGG + Intergenic
954072631 3:48154111-48154133 GCTGAGAGCAAGACAAAGGATGG - Intergenic
955802958 3:62705077-62705099 CCTTCAAGTAAGACAGAGGAGGG + Intronic
956840956 3:73139608-73139630 TTTTCAATCAAGACATAGGATGG + Intergenic
957188684 3:76977751-76977773 CTTTACATCAAAACAAAGTACGG - Intronic
958598303 3:96259703-96259725 CCTTAAATGAAGAAAAGTGAAGG - Intergenic
959585810 3:108024065-108024087 CCTAAAATCAAGACATCAGAAGG - Intergenic
963094849 3:141525166-141525188 CCTTAAAATCAGACAAAGAAAGG - Intronic
965565402 3:170111248-170111270 CTTTAAAACAAGAAGAAGGAAGG + Intronic
966433305 3:179855370-179855392 CTTTATTTCAAGACAAAGAATGG - Intronic
971033368 4:22666045-22666067 CCTTAAGACCAGAAAAAGGAGGG - Intergenic
972143974 4:35998456-35998478 CCTACAATCAACACAAAGAATGG - Intronic
973014714 4:45123855-45123877 CCTTAAAACAATACAAATGTTGG - Intergenic
976673938 4:87683908-87683930 CCTTAAATCAGGACACAGTAAGG - Intergenic
976773412 4:88679996-88680018 TCTAAACTCAGGACAAAGGAAGG - Intronic
979878758 4:125928236-125928258 CCTTTCCTCAAGCCAAAGGAAGG - Intergenic
980547479 4:134286739-134286761 ATTTTCATCAAGACAAAGGATGG - Intergenic
980713824 4:136606359-136606381 CCATAAATATAGACAAAAGAAGG + Intergenic
981265757 4:142781398-142781420 CCTTAAAGACAGAAAAAGGAGGG + Intronic
981611261 4:146596367-146596389 CATTATATCAATATAAAGGAGGG - Intergenic
981923230 4:150109875-150109897 CCTTAAATTAAAACAAAAGGTGG + Intronic
982975349 4:162049596-162049618 ACTTAATTCAAGAGAAAGGAAGG - Intronic
983982476 4:174015755-174015777 TCTTAAATTAGGAGAAAGGATGG + Intergenic
984141255 4:176006022-176006044 TCCTATATCCAGACAAAGGAAGG + Intergenic
984297602 4:177873067-177873089 CCTTGAATCACTACAAAGGTAGG - Intronic
986046914 5:4047299-4047321 ACTAAAAAGAAGACAAAGGAAGG + Intergenic
986333644 5:6736635-6736657 CCTTAACTCATGACATAGGCTGG + Intronic
986689568 5:10303074-10303096 CCTGGAATCAATAGAAAGGAGGG - Intronic
986731263 5:10636615-10636637 TCTTAAATAAACAAAAAGGATGG + Intronic
987797192 5:22643057-22643079 GCTTAAATCAAATCAAAGTAAGG + Intronic
988278299 5:29112271-29112293 TCTAAAGTCAAGATAAAGGAAGG - Intergenic
989434113 5:41391305-41391327 CCTTTCCTCAAGACAAAGGAAGG - Intronic
989612624 5:43309960-43309982 CTTTGAATCAAGGCTAAGGAGGG - Intronic
992439265 5:76783823-76783845 CCTGGAATCAATAGAAAGGAGGG + Intergenic
992542721 5:77780409-77780431 CCTGGAATCAATAGAAAGGAAGG - Intronic
992663402 5:78983773-78983795 CCTAAGATCAAGAGAAGGGAGGG - Intronic
993029743 5:82692004-82692026 AGTTAAATAAAAACAAAGGAAGG + Intergenic
993863428 5:93163546-93163568 CCTGAAATGAACACAAAAGAAGG + Intergenic
994804248 5:104422723-104422745 CCTTTAATCAAGACAAACTTAGG - Intergenic
995552287 5:113293576-113293598 CCTAAAATCATGAAAAAAGATGG + Intronic
997107448 5:131036314-131036336 CCTTAGATCAAAACAAGGCAAGG + Intergenic
998557219 5:143137289-143137311 ACTTAAATTAAGAGGAAGGATGG - Intronic
998674478 5:144391511-144391533 TCTTGAATCAAGAGACAGGATGG + Intronic
998950227 5:147386350-147386372 GCTTGAATCAAAACAAATGAAGG - Exonic
999170660 5:149591381-149591403 TCTTAAAAAAAGACAAAGGCTGG - Intronic
999454000 5:151699590-151699612 TGTTAAATCAAGACAGAGAAAGG + Intergenic
1000483157 5:161804902-161804924 CCTGAAATAAAGACAGAGAAAGG - Intergenic
1002683433 5:180988183-180988205 CCTGAACTCAAGACAAGGGAGGG + Intergenic
1003787031 6:9498058-9498080 CCTAGAATCAATAGAAAGGAAGG + Intergenic
1005522111 6:26610683-26610705 CTTTAAAGCCAGACCAAGGAAGG + Intergenic
1005636883 6:27761340-27761362 CCATGATTCAAGACCAAGGAAGG - Intergenic
1007455216 6:41971836-41971858 CCAAAAATAAAGAAAAAGGAAGG - Intronic
1007539293 6:42626259-42626281 CCTTAAATCATCAGAAAAGAAGG - Intronic
1008185631 6:48387288-48387310 TCTAAAGTCAAGACCAAGGAAGG - Intergenic
1010984140 6:82402925-82402947 TCTTAAATCAGGAAAAAAGAAGG - Intergenic
1011087416 6:83557771-83557793 CCTTAAATCAATTCAAAGATTGG + Intronic
1012532715 6:100257530-100257552 TCTAAAATAAAGACAAAAGAGGG + Intergenic
1012905129 6:105055460-105055482 CCCTTAATCAAGACTAAGGAGGG - Intronic
1012971439 6:105735925-105735947 CCCTAATTCAAAACAAATGAAGG + Intergenic
1016243682 6:141959267-141959289 CCTAAACTAAAGACAAAAGAAGG + Intergenic
1017553710 6:155540305-155540327 CCTTAAATCAGAAGAAGGGAGGG + Intergenic
1017990634 6:159485550-159485572 ACATAGATCAGGACAAAGGAAGG + Intergenic
1018130491 6:160727033-160727055 CCTAAACTGACGACAAAGGAGGG + Intronic
1020479217 7:8637119-8637141 ACTTAAATCAAGAAAATGGCAGG + Intronic
1020788652 7:12598094-12598116 ACTTAAATCAAGTCAATGAATGG + Intronic
1020995595 7:15259614-15259636 TCTAAAGGCAAGACAAAGGAAGG + Intronic
1021029900 7:15719152-15719174 CCTTTTATAAAGACAAATGACGG + Intergenic
1021850690 7:24805531-24805553 TCTTAAATCAAGCCTAAGAATGG - Intronic
1022392973 7:29959656-29959678 GTTTAAATAAAGACAAAAGAAGG + Intronic
1022721746 7:32947824-32947846 GAATAAATCAATACAAAGGAAGG - Intergenic
1023748161 7:43342301-43342323 CTTTTGATCAAAACAAAGGAAGG - Intronic
1024592085 7:50896510-50896532 ACCAACATCAAGACAAAGGAGGG + Intergenic
1026368841 7:69677785-69677807 CTTAAAATCCAGCCAAAGGATGG - Intronic
1027427081 7:78071979-78072001 CCTCAATAAAAGACAAAGGACGG - Intronic
1027632481 7:80623769-80623791 CCTCTAACAAAGACAAAGGATGG + Intronic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1028696342 7:93717537-93717559 CCTTAAACCTAGGAAAAGGAGGG + Intronic
1029375542 7:100174942-100174964 TCTTAAAGAAAAACAAAGGAAGG + Intronic
1029554285 7:101257279-101257301 CCTTAAAACAAAACAAAGCCAGG + Intergenic
1032697105 7:134346729-134346751 CCCTAAAGAAAGATAAAGGATGG + Intergenic
1033928047 7:146488320-146488342 CATTAAAGCAAGAGGAAGGAAGG - Intronic
1037427231 8:18769234-18769256 CTTTAAATGAAAATAAAGGAAGG + Intronic
1039029732 8:33296452-33296474 CCATAGATCCAGACAAAGGAGGG - Intergenic
1039151549 8:34512251-34512273 CCTTAAAGCAAAAGGAAGGATGG - Intergenic
1040463482 8:47672343-47672365 CAGTAAAACAAGACAGAGGAGGG - Intronic
1041654964 8:60339874-60339896 TCCTAAATCACGACAAAGCAAGG + Intergenic
1042350674 8:67774234-67774256 CCTGAACTCAAGACATAGAAAGG + Intergenic
1043686987 8:83099328-83099350 CTTCAAATCTAGACAAAGGATGG + Intergenic
1043876275 8:85490403-85490425 CCTAAAGTCAAGACAAAGGAAGG - Intergenic
1044176394 8:89129170-89129192 CCATAAATAAAGATAAATGAAGG - Intergenic
1044864090 8:96552305-96552327 TAATAAATCAAAACAAAGGAGGG - Intronic
1044903482 8:96973575-96973597 ACTAAAGTCAAGATAAAGGAAGG + Intronic
1045109267 8:98924559-98924581 CTTTAAATCAAAACAAAAGAGGG + Intronic
1046631145 8:116624096-116624118 CCACAAATCCAGACAACGGATGG + Intergenic
1049969056 9:805590-805612 TCTTAAAAAAAGAAAAAGGAAGG + Intergenic
1051011586 9:12421495-12421517 TCTTACATCCAGAGAAAGGAAGG + Intergenic
1051424146 9:16916929-16916951 CATAAAATCAACACAAAGGAAGG - Intergenic
1052187978 9:25621733-25621755 CCATAAAACAAAACAAAGAAAGG + Intergenic
1058169231 9:101659672-101659694 CCTTAATTTAAGAGAAAGGTTGG + Intronic
1059667852 9:116466059-116466081 CTTGAAAGCAAGACAAAGCAGGG + Intronic
1061191513 9:129085285-129085307 CCTTAAATACAGGAAAAGGAAGG - Exonic
1186744897 X:12557375-12557397 CCCTAGATCCAGACAAGGGAAGG + Intronic
1187869681 X:23754195-23754217 CCTGAACTCAAGAAAATGGAAGG - Intronic
1189599997 X:42614240-42614262 TCTAAAGTCAAAACAAAGGAAGG - Intergenic
1192289302 X:69775474-69775496 TCTTCAATAAAGGCAAAGGAAGG - Intronic
1192298205 X:69871954-69871976 TCTAAAGTCAAGACATAGGAAGG + Intronic
1192734766 X:73839840-73839862 CCTTAAGTCAAGAGGAAGGATGG - Intergenic
1193270179 X:79519648-79519670 CATTAAATAATGACAAAAGAGGG + Intergenic
1193727953 X:85065338-85065360 CCCTAATTAAAGACACAGGATGG - Intronic
1194085983 X:89529338-89529360 TCTGAAAACAAAACAAAGGATGG + Intergenic
1195514907 X:105763091-105763113 CCTGAATTAAAGACCAAGGAGGG - Intronic
1196257688 X:113541147-113541169 TCCTAAATCCAGACAAGGGAAGG - Intergenic
1197120234 X:122881944-122881966 CCTAAAGTAAAGACAAAGGAAGG + Intergenic
1197534575 X:127671991-127672013 CCTTAAATGAAGAAAAAGCTTGG + Intergenic
1197602894 X:128551162-128551184 CCTTAAATTAAGATAAAACAAGG - Intergenic
1199418323 X:147612981-147613003 CATTAAATAAAGACACATGATGG + Intergenic
1199997480 X:153034845-153034867 CATTAAATAAAGACAGAGCAGGG + Intergenic
1200438638 Y:3185204-3185226 TCTGAAAACAAAACAAAGGATGG + Intergenic