ID: 1076034000

View in Genome Browser
Species Human (GRCh38)
Location 10:127183836-127183858
Sequence AATCCTGGTGTTACTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076033997_1076034000 -1 Left 1076033997 10:127183814-127183836 CCTTAAAAATCTACCTCTTATCA 0: 1
1: 0
2: 1
3: 19
4: 235
Right 1076034000 10:127183836-127183858 AATCCTGGTGTTACTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076034000 Original CRISPR AATCCTGGTGTTACTCTGCC AGG Intronic
No off target data available for this crispr