ID: 1076037672

View in Genome Browser
Species Human (GRCh38)
Location 10:127214535-127214557
Sequence CTGAATAATACTCCTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076037671_1076037672 -7 Left 1076037671 10:127214519-127214541 CCATTCGTTTTCTTAGCTGAATA 0: 1
1: 0
2: 4
3: 40
4: 388
Right 1076037672 10:127214535-127214557 CTGAATAATACTCCTGTTGTAGG No data
1076037669_1076037672 18 Left 1076037669 10:127214494-127214516 CCAGGTTGATGGGTGCAGCTGTG 0: 1
1: 0
2: 0
3: 18
4: 272
Right 1076037672 10:127214535-127214557 CTGAATAATACTCCTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076037672 Original CRISPR CTGAATAATACTCCTGTTGT AGG Intronic
No off target data available for this crispr