ID: 1076044345

View in Genome Browser
Species Human (GRCh38)
Location 10:127279179-127279201
Sequence CAAATTACTAGACTTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076044340_1076044345 0 Left 1076044340 10:127279156-127279178 CCTTAAAACAGCTTGAAATGCCC 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1076044345 10:127279179-127279201 CAAATTACTAGACTTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076044345 Original CRISPR CAAATTACTAGACTTGTAGG TGG Intronic
No off target data available for this crispr