ID: 1076046684

View in Genome Browser
Species Human (GRCh38)
Location 10:127299931-127299953
Sequence CCTGCAAAGTTCCTTATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076046680_1076046684 28 Left 1076046680 10:127299880-127299902 CCTTTTCTCTTGCCTTTCTGAAG 0: 1
1: 0
2: 3
3: 86
4: 596
Right 1076046684 10:127299931-127299953 CCTGCAAAGTTCCTTATCTCAGG No data
1076046682_1076046684 16 Left 1076046682 10:127299892-127299914 CCTTTCTGAAGATGTGGATTTGA 0: 1
1: 1
2: 2
3: 29
4: 290
Right 1076046684 10:127299931-127299953 CCTGCAAAGTTCCTTATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076046684 Original CRISPR CCTGCAAAGTTCCTTATCTC AGG Intronic
No off target data available for this crispr