ID: 1076047048

View in Genome Browser
Species Human (GRCh38)
Location 10:127302371-127302393
Sequence GCCCCAGGAGTGGCCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076047048_1076047053 -4 Left 1076047048 10:127302371-127302393 CCCTGGGGGGCCACTCCTGGGGC 0: 1
1: 0
2: 2
3: 27
4: 269
Right 1076047053 10:127302390-127302412 GGGCCAGGAGCTGCTCCCTGAGG No data
1076047048_1076047054 -3 Left 1076047048 10:127302371-127302393 CCCTGGGGGGCCACTCCTGGGGC 0: 1
1: 0
2: 2
3: 27
4: 269
Right 1076047054 10:127302391-127302413 GGCCAGGAGCTGCTCCCTGAGGG No data
1076047048_1076047057 11 Left 1076047048 10:127302371-127302393 CCCTGGGGGGCCACTCCTGGGGC 0: 1
1: 0
2: 2
3: 27
4: 269
Right 1076047057 10:127302405-127302427 CCCTGAGGGAATTCTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076047048 Original CRISPR GCCCCAGGAGTGGCCCCCCA GGG (reversed) Intronic
900191888 1:1355568-1355590 GCCCCGGGGGTGGCCCCGCGCGG - Exonic
900400832 1:2472272-2472294 GCCCCTGGACTGGCGCCGCACGG - Intronic
901628202 1:10635293-10635315 GCCCCACGGGAGGCCCACCAGGG + Intergenic
903758992 1:25684705-25684727 GCACCAGGAGTGGCCGAGCATGG + Intronic
904276000 1:29384662-29384684 GCCCCTGTGGTGGCCCCCCCTGG - Intergenic
905793361 1:40801984-40802006 GCCAAAGGAGTTGCCCACCAAGG - Intronic
906051807 1:42880672-42880694 GGCCCACGTGTGGCCACCCATGG - Intergenic
908599280 1:65721743-65721765 GCCCCTGTAGGGGCCTCCCATGG - Intergenic
913050693 1:115114433-115114455 GCCCCTGGAATGCCCTCCCAGGG + Intergenic
915179822 1:154048558-154048580 GGCCCAGGATAGGCCCCTCATGG - Intronic
915601858 1:156927535-156927557 GGCCCAGGAGTTGCGCCCCGCGG - Exonic
915616308 1:157042253-157042275 GCCCCAAGACTGAACCCCCAAGG + Intronic
916772564 1:167926555-167926577 CAACCAGGAGTGTCCCCCCAGGG + Intronic
919066009 1:192693538-192693560 GCCGCAGGGGTGGGCCCTCATGG - Intergenic
919741355 1:200983290-200983312 CCCCCAGGAGTGGGCTGCCAGGG + Intronic
919856484 1:201709653-201709675 GCCCCAGCAGTGGCCCCTGGTGG - Intronic
920427844 1:205892642-205892664 GGCCCAGGATGGGCCCCTCATGG - Intergenic
920682431 1:208083336-208083358 GTGCCAGGACTGGCCACCCAGGG - Intronic
920703815 1:208237239-208237261 GCCCGAGGAGTGGACAGCCAAGG + Intronic
922802000 1:228368663-228368685 GCCCCAGGAGTCACCCCCTTAGG + Intronic
922818660 1:228469634-228469656 GCCCCAGGAGTCGCCCCTGATGG - Intergenic
922987875 1:229880448-229880470 GGCCCTGGGGTGGCCCCACACGG + Intergenic
1062867769 10:871334-871356 GCACAAGGAGTGCCCCCCGATGG - Intronic
1066010320 10:31188516-31188538 TCCCCAGCAGGGGCCACCCATGG + Intergenic
1066990579 10:42509474-42509496 GGCCCAGGATGGGCCCCTCATGG + Intergenic
1067473874 10:46553929-46553951 GCCAGAGGAGGGGCCTCCCAGGG + Intronic
1069309174 10:67011935-67011957 GCCCCAGGAGTACCCATCCATGG + Intronic
1069683467 10:70301261-70301283 CCCCCAGGCTTGGCCTCCCATGG + Exonic
1072725041 10:97807480-97807502 GCTCCAGGAGGGGCCACTCAGGG + Intergenic
1073327577 10:102651383-102651405 GCCCAGGGAGTGACCCCTCAGGG - Intronic
1073766089 10:106684466-106684488 GCCTCAGGATTGGGCTCCCAAGG - Intronic
1074767207 10:116708092-116708114 GCCCCAGGAATGGGCCCCCCGGG + Intronic
1075016090 10:118910845-118910867 GACCCAGGAGTCACCCTCCATGG - Intergenic
1075426416 10:122345172-122345194 GCCCAAGGAGAGCCCTCCCAGGG + Intergenic
1075807376 10:125199745-125199767 GGCCCTGCAGTGGCCCCACAGGG + Intergenic
1076047048 10:127302371-127302393 GCCCCAGGAGTGGCCCCCCAGGG - Intronic
1076416377 10:130292742-130292764 GGCCCAGGACAGGCCCCTCATGG - Intergenic
1076680647 10:132169631-132169653 GCCCCATGGGGGGCCGCCCAGGG + Intronic
1076715052 10:132359482-132359504 CACCCAGCAGTGGCCACCCAAGG - Intronic
1076736636 10:132462028-132462050 GCCCAAGGAGGGGCCCGGCAGGG - Intergenic
1076846288 10:133071071-133071093 GCCCCGGGTGTGGCCCCCAGCGG - Intronic
1077612956 11:3655761-3655783 GCCCCAGGACTGGTGCCCTAAGG - Intronic
1078341194 11:10498937-10498959 GACTCAGGAGCAGCCCCCCAGGG + Intronic
1083619524 11:64042047-64042069 GCTCCAGGCCTGGCCCACCATGG - Intronic
1083681565 11:64354067-64354089 CCCCCAGGCGCAGCCCCCCAGGG - Exonic
1083990268 11:66242364-66242386 GCCCCATGCCTGACCCCCCAGGG - Intronic
1084030144 11:66476309-66476331 CCCCCAACTGTGGCCCCCCAAGG + Exonic
1085472595 11:76767797-76767819 GCCCCAGGAGGGGCCCAGGAAGG - Intergenic
1085706683 11:78792621-78792643 GCACCAGGTGTGGCCCAGCATGG + Intronic
1088991806 11:114960500-114960522 GAGGCAGGAGTGGCCTCCCAAGG + Intergenic
1089134467 11:116238230-116238252 GCCGCAGGCCTGGCCCCCAAAGG + Intergenic
1089287710 11:117418283-117418305 GCCCCAGCAGTGGCCCTACAGGG - Intergenic
1090275309 11:125414544-125414566 GGCCCAGGTGTGGCCTGCCAAGG - Intronic
1091116856 11:133021359-133021381 ACCCCAGGAGAGAGCCCCCAGGG + Intronic
1091587092 12:1822542-1822564 GCCTCCTGAGTGGCCCCTCATGG - Intronic
1091625286 12:2116730-2116752 CCCACAGGAGAGGCTCCCCAGGG + Intronic
1095953855 12:47795710-47795732 TCCCCAGGATTGGCCCCCGAGGG + Exonic
1097147491 12:56951759-56951781 GACCCTTGAGTGGCCACCCACGG + Exonic
1097161557 12:57049825-57049847 GCCCCAGATGGGGCGCCCCAAGG + Intronic
1097351778 12:58556766-58556788 GCCTCAGCAGTGCCTCCCCAAGG + Intronic
1101223643 12:102666218-102666240 GGCCCAGGATGGGCCCCTCATGG + Intergenic
1104422245 12:128645687-128645709 GCCCCAGCAGGGGCCCCCTTTGG + Intronic
1104625923 12:130354605-130354627 GCCCTGGCAGTGTCCCCCCAGGG - Exonic
1104658707 12:130593166-130593188 GGCCCCGGTGTGGCTCCCCAAGG + Intronic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1105352416 13:19627730-19627752 GGCCCAGGATGGGCCCCTCATGG - Intergenic
1105704805 13:22962274-22962296 GGCCCCAGAGTGGCCCTCCACGG + Intergenic
1108371645 13:49775387-49775409 GCCCTAGGGGTGGCCACCCGGGG - Intronic
1115348230 14:32365605-32365627 GGCCCAGGAGTGGCACCCATGGG - Intronic
1117082394 14:52165664-52165686 GGCCCAGGATGGGCCCCTCATGG - Intergenic
1119713418 14:76840232-76840254 AGCCCAGGACTGGCCCCCCTGGG + Intronic
1121180665 14:91926225-91926247 GCCCCAGGTGTGGGCACCGAGGG - Intronic
1121315981 14:92961253-92961275 GCCCCAGGTGTGGCTCCTGAGGG + Intronic
1122059053 14:99124525-99124547 TCCCCAGGAGGCGTCCCCCATGG - Intergenic
1128683110 15:69665822-69665844 GCCCCAGGAGGGGACCTCTAAGG + Intergenic
1132263794 15:100448698-100448720 GCCACAGCAGTGCCCCCACATGG - Intronic
1132346534 15:101112199-101112221 GCCCCAGGCTTGTCCCCCCTGGG - Intergenic
1132651228 16:1022227-1022249 CCCCCAGGAGGGGCCCCACCTGG - Intergenic
1132674560 16:1116382-1116404 GGCCCAGGACTGCCCCACCATGG + Intergenic
1132684661 16:1157276-1157298 GCCCCGGGAGACGCCTCCCAGGG - Intronic
1132686190 16:1163142-1163164 GACCCAGGATCGGCTCCCCAGGG - Intronic
1133117779 16:3587945-3587967 GCCCCAGGTGTCGGCCCCCTCGG - Intronic
1136286509 16:29247275-29247297 TCCCCAGAAGTGGCCCTCCGTGG + Intergenic
1137573224 16:49579998-49580020 GCAGCAGCAGTGGCCACCCACGG + Intronic
1138110825 16:54322513-54322535 GGCCCAGCACTGGCCCTCCAGGG - Intergenic
1138869290 16:60861942-60861964 TCCCCAAGAGTGGTCGCCCAGGG - Intergenic
1141193468 16:81841986-81842008 GCCCCAGGAGGGCTCCACCAAGG - Intronic
1142045789 16:87924488-87924510 GCCCGGGGAGAGGCACCCCATGG - Intronic
1142092096 16:88219849-88219871 TCCCCAGAAGTGGCCCTCCGTGG + Intergenic
1142386733 16:89770117-89770139 GCCCTCAGAGTGGGCCCCCAAGG + Intronic
1143164489 17:4891103-4891125 GCCCCAGGAGGGACCGCACAAGG + Exonic
1143676444 17:8436236-8436258 GTCCGATGTGTGGCCCCCCAGGG + Intronic
1145002314 17:19313947-19313969 ACACCAGGAGGGGCCTCCCAGGG - Intronic
1145219743 17:21078378-21078400 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1147135558 17:38432055-38432077 GCCCCGCCTGTGGCCCCCCAGGG + Intronic
1148197145 17:45722198-45722220 GGCACAGGAGTGGCCCCCCTGGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151803466 17:76391229-76391251 GCCCCAGGAGAGGCCTCCCAGGG - Exonic
1152104022 17:78318547-78318569 GCCTAAGGACTGGCCTCCCAGGG - Intergenic
1152111341 17:78359287-78359309 GGCCCAGGAGAGGGCCCCCGGGG - Intronic
1152588489 17:81199648-81199670 GCCCCAGCAGCAGCCCCGCACGG + Intronic
1160775378 19:852919-852941 GCCCCACGCGTGGCCCTTCATGG + Exonic
1161579577 19:5073429-5073451 GCACCAGGAGGGGCCCGCCTGGG - Intronic
1161590803 19:5128347-5128369 GCCCCAGGTGGGGCCCTCCTGGG + Intronic
1161678763 19:5668175-5668197 GCCCCAGGCGGGGCCTCCCGGGG + Exonic
1161767585 19:6215973-6215995 GCCCCAGGACGGGCTCTCCATGG + Intronic
1162124301 19:8490955-8490977 GCCACAGCAGTTGCCACCCATGG - Exonic
1162252312 19:9456072-9456094 GGCTCAGGATTGGCCCCTCATGG - Intergenic
1162283146 19:9716572-9716594 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1163036419 19:14571805-14571827 ACCCCAGGGCTGGCACCCCAGGG - Intronic
1163125305 19:15241230-15241252 GCCCCAGGTCTGGCCTGCCAGGG + Intronic
1163163637 19:15480450-15480472 GCCCCAGGGGTGGCCCCCAGGGG - Intronic
1163268537 19:16235519-16235541 GGCCCAGGAGTGGTGGCCCATGG - Intronic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163502021 19:17681826-17681848 GCTCCAAGAGGGGTCCCCCAGGG - Intronic
1164261981 19:23576026-23576048 GGCCCAGGATGGGCCCCTCATGG + Intronic
1165223509 19:34337530-34337552 GCCTCAGGAGTGACCCAGCATGG + Intronic
1166659123 19:44634207-44634229 GGCCCAGGACAGGCCCCTCATGG + Intronic
1166851989 19:45765599-45765621 CCCCCAGGAGCAGCCCCTCAGGG + Exonic
1168655691 19:58125907-58125929 GCCCCATGAGTGGATCCCCTTGG - Intergenic
1202646232 1_KI270706v1_random:144589-144611 GCCCCAGCAATAGCCTCCCAGGG + Intergenic
925362029 2:3286394-3286416 GCCCCAGGAGTGGGCCCAGAAGG + Intronic
926251918 2:11159615-11159637 CACACAGGAGGGGCCCCCCAGGG - Intronic
926748860 2:16182167-16182189 GTACCAGGAGTGGACCCCAAAGG + Intergenic
928167451 2:28981413-28981435 GCCCCAGGCCTGGCCCACCCTGG - Exonic
928309484 2:30197666-30197688 GCCCCAGGAGTGGCCTGCTCAGG + Intergenic
929390940 2:41467640-41467662 ACCCCAGAACTGGCCCACCAGGG + Intergenic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
934079156 2:88452615-88452637 GCCGCAGGGTTGGCCCCCAAAGG - Exonic
934509369 2:94925016-94925038 GCCCCAGCAATAGCCTCCCAGGG + Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
936462374 2:112722832-112722854 CCCCAAAGAGGGGCCCCCCAAGG + Intronic
937232486 2:120406183-120406205 GCCACAGGAGTGGCTCCCAGGGG - Intergenic
937297545 2:120818650-120818672 GCCCCAGGCGTGTCTCTCCAGGG + Intronic
938540421 2:132280259-132280281 GCCCCAGTTGTGGCCACCCATGG - Intergenic
941396632 2:164981903-164981925 GCCCCTGGAGTGGCCACCTTAGG - Intergenic
947800594 2:232927131-232927153 GCCCGAGGAGTGGCCGGCCCTGG - Exonic
948988748 2:241541362-241541384 CCCCCACGCGTGGCCCCGCACGG - Intergenic
1168924115 20:1565810-1565832 GTCCCAGCAGTGGCCTCCAAGGG + Intronic
1169859649 20:10137835-10137857 GCCACAGGAGTGGCTTCCCAAGG - Intergenic
1170410290 20:16082165-16082187 CCTCCAGGAATGGGCCCCCAAGG - Intergenic
1171359549 20:24577427-24577449 GCCCCAGCACTGGCCCTGCAAGG + Intronic
1171438396 20:25141504-25141526 CCCCCTGGAGTGGCTTCCCAGGG - Intergenic
1171849664 20:30299543-30299565 GCCCAAGGAGTATCCCCCCCGGG + Intergenic
1171869346 20:30513264-30513286 GCCCCAGTTGTGGCCGCCCATGG - Intergenic
1172502634 20:35437769-35437791 GGCCAAGGAGAGGCCCCCCCTGG - Exonic
1175445113 20:59014708-59014730 CCCCCAGGAGTTATCCCCCAGGG - Intergenic
1175632022 20:60549372-60549394 TCTCCAGGATTGGCCCCCGATGG + Intergenic
1175821617 20:61913174-61913196 GCTACAGAAGTGGCCCTCCAAGG - Intronic
1176416014 21:6475191-6475213 AAGCCAGGAGTGGCCCCTCATGG - Intergenic
1176605642 21:8828172-8828194 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1179656697 21:42850358-42850380 GTCCCAGAAGGCGCCCCCCACGG - Intronic
1179691514 21:43083525-43083547 AAGCCAGGAGTGGCCCCTCATGG - Intergenic
1179959972 21:44762666-44762688 GGCCCAGGAGTGGCCAGCTAAGG + Intergenic
1180174902 21:46082707-46082729 GTCCCAGGCGTGGCACCCCAGGG - Intergenic
1180214282 21:46314781-46314803 GCCCCCAGAGCTGCCCCCCACGG - Exonic
1180347939 22:11719776-11719798 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1180355717 22:11837878-11837900 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1180382536 22:12154447-12154469 GCCCCAGCAATAGCCTCCCAGGG + Intergenic
1181046652 22:20217799-20217821 GCTCCAGGAGTGGACCCACATGG + Intergenic
1181629421 22:24142780-24142802 GCCCCAGGACTGTCCACACAGGG + Intronic
1182096780 22:27630911-27630933 GCCTCTGGAGTGGCTCCCCCTGG - Intergenic
1182103666 22:27674128-27674150 GCCCCGGGGGAGGCCCCCCGGGG + Intergenic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183018615 22:35009623-35009645 GCCCCAGGAGGAGACCCCCATGG + Intergenic
1183107927 22:35627942-35627964 GCTCCAGGGAGGGCCCCCCAGGG + Intronic
1183453919 22:37911212-37911234 GCCCCAGGAGTGGCCCAGTGGGG + Intronic
1183456431 22:37925669-37925691 CCCCCAGGAAGGACCCCCCATGG + Exonic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184369873 22:44075501-44075523 GCACCAAGAGGGGCCCCTCATGG - Intronic
1184744508 22:46448355-46448377 GCTCCTGGAGCAGCCCCCCAGGG - Intronic
1185218980 22:49619487-49619509 GGCCCAGGGGTGGCCTCACAGGG + Intronic
950185816 3:10944939-10944961 CCCCCAGGCAGGGCCCCCCAAGG - Intergenic
950554874 3:13689338-13689360 GCCTCAGGATTGTCCTCCCAGGG + Intergenic
951270541 3:20618518-20618540 GCCCCGGGATGGGCCCCTCATGG + Intergenic
953189476 3:40670113-40670135 TCCCCCAGAGTGGCCCCACATGG - Intergenic
953979198 3:47405257-47405279 GCCCCAGCAGAGGCTCCCCACGG - Intronic
954809326 3:53238463-53238485 TCCCCAGGACTGGCTCTCCAAGG - Intronic
954939015 3:54353848-54353870 GCCTCAGGAAAGGCCCCTCAGGG + Intronic
955063609 3:55515743-55515765 GCCCCAGGACAGACGCCCCAGGG + Intronic
961323288 3:126093367-126093389 GGCCCAGGACAGGCCCCTCATGG - Intronic
961336014 3:126180218-126180240 GCGCCAGGACTGGCCCGCCGAGG - Intronic
961473879 3:127135258-127135280 GCCCCACGCGTGGCCCCGGAGGG + Intergenic
963051863 3:141149827-141149849 GCCCCAGGAGTGGCATCCTCAGG - Intergenic
965703604 3:171483588-171483610 GCGCCAGGAGTGTGCCCTCAAGG - Intergenic
966974080 3:185069854-185069876 GGCCCAGGAGAAGCCCTCCACGG - Intergenic
968601798 4:1513112-1513134 GCCCCAGGAGGGTCCCAGCACGG + Intergenic
968660217 4:1795722-1795744 GGACCTGGAGTGACCCCCCAGGG + Intronic
969640746 4:8397072-8397094 GCCCGAGGACAGGCTCCCCAGGG + Exonic
969668299 4:8574956-8574978 GCCCCAGGGGTGGCCCACCCTGG - Intronic
972251693 4:37309084-37309106 GGCCCAGGACTGGCCCACCAAGG - Intronic
976977799 4:91185606-91185628 GGCCCAGGACAGGCCCCTCATGG + Intronic
977642045 4:99368143-99368165 GGCCCAGGACTGGCCCCTCATGG - Intergenic
978489988 4:109302349-109302371 GCCCCAACAGTGGCCGCTCAGGG + Exonic
982311328 4:153988373-153988395 CCCCCAGAAGTGGCCACCCAGGG - Intergenic
984169776 4:176345690-176345712 GGCCCAGGAGGGACCCCTCATGG - Intergenic
985489033 5:168293-168315 GCCCCAGGGATGGCCCTCCACGG - Intronic
985500850 5:244092-244114 GACCCAGGACGGGCCCCTCATGG - Intronic
985736009 5:1583432-1583454 GACCCAGGACGGGCCCCTCATGG + Intergenic
985872557 5:2568879-2568901 GCCCCAGGAGGGGACCTGCATGG - Intergenic
986125643 5:4880528-4880550 GCACCAGGGGTGCCCCCGCAAGG + Intergenic
986205806 5:5623903-5623925 GTCCAAGGGGTGGTCCCCCAAGG - Intergenic
986323968 5:6657714-6657736 GGCCCAGGAGGGCCCTCCCATGG - Intronic
993405977 5:87512283-87512305 GGCCCAGGACGGGCCCCTCATGG - Intergenic
998383871 5:141744786-141744808 TCCCCAGAAGTGTCTCCCCATGG - Intergenic
1001123667 5:168999779-168999801 GCCCCAGGGCCGGCCCTCCATGG - Intronic
1001663831 5:173416190-173416212 GCCTCAGCTGTGGCCCACCATGG - Intergenic
1002056264 5:176599513-176599535 TCCCCAGGAGTCACCCTCCAAGG - Exonic
1002080359 5:176733818-176733840 ATCCCAGGAGGGGCCCCTCAAGG + Intergenic
1002299572 5:178249470-178249492 GCCCCATGAGTGCCCCCAGAGGG - Intronic
1002697276 5:181099371-181099393 CACCGAGGAGTAGCCCCCCAGGG + Intergenic
1003481152 6:6534603-6534625 GCAGAAGGAGTGGCCCCCCGGGG - Intergenic
1005838100 6:29723189-29723211 GCCCCAGGAGTGGCTCTCAAGGG + Intronic
1006038564 6:31234112-31234134 GCCCCGGGATGGGCCCCTCATGG + Intergenic
1006163126 6:32049516-32049538 CCCCCAGGAGCGGCTCCTCAGGG + Intronic
1006163767 6:32052916-32052938 CCCCCAGGAGCGGCTCCTCAGGG + Intronic
1006164382 6:32056097-32056119 CCCCCAGGAGCGGCTCCTCAGGG + Intronic
1006165379 6:32061643-32061665 CCCCCAGGAGCGGCTCCTCAGGG + Intronic
1007161156 6:39792644-39792666 GACCCCGGAGTGGGCTCCCAGGG + Intronic
1007167771 6:39841025-39841047 GCCCCTGGAGCTTCCCCCCATGG - Intronic
1007721015 6:43885506-43885528 GTCCCAGGAGTCCCCCCTCAAGG - Intergenic
1007774269 6:44216114-44216136 CCCCCAGGAGAGGGCCCACAGGG + Intergenic
1009955460 6:70447649-70447671 GGCCCAGGATGGGCCCCTCATGG + Intronic
1011734923 6:90300578-90300600 CCCCCAGGAGTGGGCCCCCAAGG - Intergenic
1012254492 6:97016312-97016334 GCCACAGGGGTGGCTGCCCAAGG + Intronic
1012867439 6:104634872-104634894 CCCCCAAAAGTGGCCCACCAAGG - Intergenic
1013242651 6:108260676-108260698 GACCCGGGAGTGGACCCCCGCGG - Intronic
1013475258 6:110501124-110501146 GGCCCAGGATGGGCCCCTCATGG - Intergenic
1013519307 6:110917958-110917980 GGCCCAGGACAGGCCCCTCATGG - Intergenic
1014191474 6:118501272-118501294 GGACCAGAAGTGGCACCCCAAGG - Intronic
1014790568 6:125667441-125667463 GCCTCACGAGCGGCCCCGCAGGG + Intergenic
1016408818 6:143760505-143760527 GCCCCAGCAGTGGCCCCTTTCGG - Exonic
1017879207 6:158548053-158548075 GCCACAGGCCTGGCTCCCCAGGG + Intronic
1019068598 6:169323362-169323384 ACCCCAGGAGTGACTCCCGAAGG - Intergenic
1019286942 7:228423-228445 CCCCCAAGACTGGCCACCCAGGG + Exonic
1019347493 7:538143-538165 GCCCCAGGCTGGGCCCTCCACGG - Intergenic
1019409015 7:898585-898607 CCCCCAGGAGCCGCCCACCACGG - Exonic
1019413309 7:916034-916056 GCCCCTGGAGTGGCCCTTCTGGG - Intronic
1023676605 7:42636487-42636509 GGCCCAGGACGGGCCCCTCATGG - Intergenic
1023842852 7:44106715-44106737 GCCCAAGGAGAAGCCACCCAAGG + Exonic
1023997228 7:45167684-45167706 GCCTCAGGAGAGGCTTCCCAAGG - Intronic
1024073075 7:45802551-45802573 GCCCCAGGAATAACCTCCCAGGG - Intergenic
1024588623 7:50862040-50862062 GCTCCAGGATTGGTCCCCGAGGG - Intergenic
1024589667 7:50870354-50870376 GGTCCAGGAATGGCCCCCCATGG - Intergenic
1024911285 7:54450116-54450138 GGCCCAGGACGGGCCCCTCATGG - Intergenic
1025098461 7:56115952-56115974 ACCCTAGGAGCGTCCCCCCACGG - Intronic
1025185602 7:56855948-56855970 GCCCCAGCGATGGCCTCCCAGGG + Intergenic
1025686327 7:63721002-63721024 GCCCCAGCAATGGCCTCCCAGGG - Intergenic
1026850088 7:73718816-73718838 GCCCCAGGAGCCACACCCCAGGG + Intronic
1029229023 7:99050969-99050991 CCCCCAGGAATGGTCCCCGAGGG + Exonic
1029284381 7:99455909-99455931 TCCCCAGCAGTGGCTCCCCAAGG + Intronic
1029694055 7:102201668-102201690 GCCCCCGGGCTGGACCCCCAGGG + Exonic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032846693 7:135757362-135757384 GCCACAGTAGTGACCCTCCAGGG - Intergenic
1034902017 7:154913842-154913864 GCCTGAGGAGTGGCCTCCCAGGG - Intergenic
1035299293 7:157886916-157886938 GCCCCAGGACTGGCCCACTGTGG - Intronic
1035299307 7:157886967-157886989 GCCCCAGGACAGGCCCGTCATGG - Intronic
1036157997 8:6360249-6360271 GCCCCAGGAGTGGGGTGCCATGG + Intergenic
1041018976 8:53619021-53619043 GGCCCAGGACGGGCCCCTCATGG - Intergenic
1042446451 8:68890592-68890614 GTCCCAGGACGGGCCCCTCATGG - Intergenic
1044858061 8:96495220-96495242 GCCCCAGAAGCGCCCCGCCAGGG - Intronic
1045283748 8:100772353-100772375 GCCACAGAAGGGTCCCCCCAAGG + Intergenic
1047562945 8:126008992-126009014 GGCCCAGGATGGGCCCCTCATGG - Intergenic
1047771470 8:128033514-128033536 GCCTCTGGGGTGGCCGCCCAGGG - Intergenic
1049198547 8:141328670-141328692 GGCCCAGTAGTGGCACCACAGGG + Intergenic
1049287601 8:141784501-141784523 ACCCCAGGACGGGCCTCCCAGGG - Intergenic
1049513637 8:143042493-143042515 GCCCCAGGAGCACCTCCCCAAGG + Intronic
1051663275 9:19445104-19445126 GACCCAGGAGTGGTCCCCTCCGG + Intronic
1053656063 9:40219249-40219271 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1053906409 9:42848451-42848473 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1054352428 9:64029278-64029300 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1054368169 9:64365473-64365495 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1054528551 9:66157046-66157068 GCCCCAGCAATAGCCTCCCAGGG + Intergenic
1054675789 9:67855216-67855238 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1055030451 9:71768281-71768303 GTCCCCGCAGTGGCCCCCGAGGG + Intronic
1055887850 9:81085784-81085806 ACCCCAGGAGTGGCCCCTGTGGG - Intergenic
1056672132 9:88639430-88639452 ACCACAGGAGTGGCCACTCAAGG + Intergenic
1057293285 9:93820537-93820559 GCCCCAGGACTGGCCCTCAGAGG + Intergenic
1057372996 9:94490824-94490846 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1057836531 9:98449817-98449839 GCCCTGGGATTGGCCCTCCATGG - Intronic
1061194887 9:129102269-129102291 GCCCCAGGAATGGGCGCCCCTGG - Intronic
1061793790 9:133071791-133071813 GCCACAAGAGTGGGACCCCAGGG + Exonic
1062461789 9:136665467-136665489 GAGCCAGGAGAGGCCGCCCAGGG - Intronic
1062463160 9:136670290-136670312 GCCCAAGGGAGGGCCCCCCAGGG + Exonic
1062560805 9:137141038-137141060 TCCCCAGGAATGGCCCCTCCTGG - Intronic
1203553035 Un_KI270743v1:180180-180202 GCCCCAGCAATAGCCTCCCAGGG - Intergenic
1185757254 X:2661683-2661705 GCCCAAGGTGTGGCCCTGCAGGG + Intergenic
1189276980 X:39793874-39793896 CCCCCAGGACTGACCCTCCAGGG + Intergenic
1190844947 X:54182965-54182987 GCCCCCGGAGTAGGCACCCAAGG + Exonic
1191580704 X:62757764-62757786 GGCCCAGGATAGGCCCCTCATGG + Intergenic
1194536111 X:95107302-95107324 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1196738331 X:119000565-119000587 GCCCCAGAGGTGGCCCCCAATGG - Intronic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic
1198522195 X:137464476-137464498 AGCCCAGCAGTGGCCCCTCAGGG + Intergenic
1198541160 X:137641263-137641285 ACCCCAGGACTGGCTCCACAGGG - Intergenic
1200962952 Y:9011737-9011759 GAGCCAGCAGTGGCCACCCACGG - Intergenic
1200970684 Y:9149357-9149379 GGCCCAGGATGGGCACCCCATGG + Intergenic
1201154318 Y:11115835-11115857 GCCCCAGCAATAGCCTCCCAGGG - Intergenic