ID: 1076047887

View in Genome Browser
Species Human (GRCh38)
Location 10:127309317-127309339
Sequence TCTGATATCCAGAATCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10319
Summary {0: 3, 1: 53, 2: 1166, 3: 4082, 4: 5015}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076047887_1076047888 -9 Left 1076047887 10:127309317-127309339 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1076047888 10:127309331-127309353 GATATCAGACCTTTGTCAGATGG 0: 29
1: 1203
2: 5577
3: 3321
4: 1595
1076047887_1076047891 24 Left 1076047887 10:127309317-127309339 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1076047891 10:127309364-127309386 AAAATTTTCTCCCATTCTGTAGG 0: 8879
1: 14882
2: 10936
3: 7247
4: 5330
1076047887_1076047889 -8 Left 1076047887 10:127309317-127309339 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1076047889 10:127309332-127309354 ATATCAGACCTTTGTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076047887 Original CRISPR TCTGATATCCAGAATCTGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr