ID: 1076050716

View in Genome Browser
Species Human (GRCh38)
Location 10:127331093-127331115
Sequence CAAGTGGCTAAAGGTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076050713_1076050716 -7 Left 1076050713 10:127331077-127331099 CCACTTATGGCTCAGACAAGTGG No data
Right 1076050716 10:127331093-127331115 CAAGTGGCTAAAGGTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076050716 Original CRISPR CAAGTGGCTAAAGGTGATAT AGG Intronic
No off target data available for this crispr