ID: 1076051080

View in Genome Browser
Species Human (GRCh38)
Location 10:127333625-127333647
Sequence CTTTTGTTCTTGAACAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 462}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076051080_1076051085 -10 Left 1076051080 10:127333625-127333647 CCCTTTTTGTTCAAGAACAAAAG 0: 1
1: 0
2: 3
3: 41
4: 462
Right 1076051085 10:127333638-127333660 AGAACAAAAGCAAGGCTGGCGGG No data
1076051080_1076051091 27 Left 1076051080 10:127333625-127333647 CCCTTTTTGTTCAAGAACAAAAG 0: 1
1: 0
2: 3
3: 41
4: 462
Right 1076051091 10:127333675-127333697 CTTCATGCTGCAGAGAGGCTTGG No data
1076051080_1076051089 22 Left 1076051080 10:127333625-127333647 CCCTTTTTGTTCAAGAACAAAAG 0: 1
1: 0
2: 3
3: 41
4: 462
Right 1076051089 10:127333670-127333692 AGAACCTTCATGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076051080 Original CRISPR CTTTTGTTCTTGAACAAAAA GGG (reversed) Intronic
900228045 1:1541824-1541846 TTTTTCTTCTTTAACCAAAAAGG - Exonic
900327230 1:2114328-2114350 CTTATTTTGTTGGACAAAAAAGG + Intronic
901774719 1:11552454-11552476 CTTTTGGACTTGAACTGAAATGG + Intergenic
902890430 1:19439394-19439416 CTTTTGTTCTTGAAGAACCACGG + Intronic
905082224 1:35333748-35333770 TTTTTCTTATTTAACAAAAATGG + Intronic
905468207 1:38171852-38171874 CCTTTTTTCTTGATCACAAATGG + Intergenic
905852543 1:41284791-41284813 CTTTTTTTCTTTAAATAAAAGGG - Intergenic
906264647 1:44418625-44418647 TTTTTGTTTTCAAACAAAAAAGG - Intronic
907853887 1:58282596-58282618 CCTTTGTTCTAAAAAAAAAAAGG + Intronic
907868782 1:58424158-58424180 CTTTTGGACTTGAACGAAAATGG - Intronic
908511598 1:64854103-64854125 CTTGTGTTCTTGATCAGATAGGG - Intronic
909154099 1:72048830-72048852 TTTTTGTTCTGAAACAAAAAAGG + Intronic
909201673 1:72697138-72697160 CTTTTGATTTTGAAAAAAAGAGG - Intergenic
909930722 1:81496357-81496379 CTTTTTTTCTTTAGCAAAAAAGG + Intronic
910864144 1:91772339-91772361 CTTTAGATCCTAAACAAAAATGG - Intronic
911362379 1:96894802-96894824 CTTTTGTTCTTGAACTTTCATGG + Intergenic
911888614 1:103337752-103337774 TTTGTGTTCTAGAAGAAAAAAGG - Intergenic
913124328 1:115771388-115771410 GTTTTGTTTTTAAACAAGAAGGG + Intergenic
913298447 1:117344978-117345000 CTTTTCTTATTTAATAAAAATGG - Intergenic
913557809 1:119986407-119986429 TTTTTGTTCGTGTACAAAAAGGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917614037 1:176719341-176719363 TTTTTGTTTTTTCACAAAAAAGG - Intronic
917942319 1:179934733-179934755 ATTTTGTTCATGAACAAAAACGG + Intergenic
918115764 1:181496343-181496365 ATTTTGTCTTTGAACAAAAATGG + Intronic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
918742270 1:188147890-188147912 CTTTTGTTCTTGCACATATTTGG - Intergenic
919117317 1:193296736-193296758 CTTTTCTTCTTGAAACACAAGGG - Intergenic
919586078 1:199442197-199442219 CTTTACTTCTTCAAAAAAAATGG + Intergenic
920697506 1:208192444-208192466 TTTTTGTTGTTTAAAAAAAAAGG - Intronic
921089419 1:211829868-211829890 TTTTTTTTCTTAAAAAAAAAAGG - Intronic
921416509 1:214894197-214894219 CTTTTTTTTTTTAACAAAGATGG + Intergenic
922909244 1:229201860-229201882 GTTTTATTCCTGAAAAAAAAGGG - Intergenic
923469951 1:234281671-234281693 GTTTTGTTCTTGAACTGGAAAGG + Intronic
923794656 1:237142302-237142324 CTGTTATTCATGGACAAAAAGGG + Intronic
923984867 1:239370119-239370141 CTTTTGTGCTTGTAAAAAAATGG - Intergenic
1063280393 10:4623120-4623142 CTTTTCTACTTGAAGACAAATGG - Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064176963 10:13083414-13083436 GATTTATTCTTTAACAAAAAGGG - Intronic
1064791521 10:18961773-18961795 GTTATGTTCATGAACAAACAAGG - Intergenic
1064826852 10:19413552-19413574 CTTTTAATCATGAAAAAAAAAGG + Intronic
1065338155 10:24676238-24676260 CTTGTGTTCTTGAAGAATGATGG - Intronic
1065772868 10:29093881-29093903 ATGTTCTTCTTGAACAAACATGG - Intergenic
1067901376 10:50244991-50245013 CTTCTGCTCATGAAAAAAAAAGG + Intronic
1068737401 10:60429918-60429940 CTTTTTTTCTTTTAGAAAAACGG - Intronic
1068782604 10:60937721-60937743 CTTTTTTTCTTGAACACAACAGG - Intronic
1068784374 10:60954844-60954866 CTTTTATTATTTAACATAAATGG + Intronic
1068898192 10:62231802-62231824 CTTTTAGTCTTTAACCAAAATGG - Intronic
1069439645 10:68416497-68416519 CATTTGTTCTGGATTAAAAAAGG + Intronic
1070685851 10:78480355-78480377 CCTTTTTTCTTAAACAAACATGG - Intergenic
1071017894 10:81020058-81020080 CTTTTATTATTGAGCATAAAAGG - Intergenic
1072029135 10:91500364-91500386 CGATTTTTCTTCAACAAAAATGG + Intronic
1072077774 10:91995259-91995281 CTATTGTTATTTAACACAAAAGG + Intronic
1072201371 10:93161768-93161790 GTTATTTTCTTGAACAAAGATGG - Intergenic
1073079328 10:100848384-100848406 TTTTTGTTTTTTTACAAAAATGG - Intergenic
1073812690 10:107167643-107167665 ATTTTCATCTTGCACAAAAATGG - Intergenic
1074720685 10:116262668-116262690 CTATTGTTCTACAACAAAAATGG + Intronic
1075600413 10:123763538-123763560 CTTTTGATCTAAAAAAAAAAAGG + Intronic
1075708451 10:124517334-124517356 GTTTTGTTCTTCAAAATAAAGGG + Intronic
1075867555 10:125739199-125739221 CTTCTTTTCCTGAACAAACATGG + Intronic
1075908081 10:126099977-126099999 CTTTTATACTTAAAAAAAAAAGG - Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1079626875 11:22626767-22626789 GTTTTGTACTTTAACAAAAAGGG + Exonic
1081051902 11:38351628-38351650 CTGTTGTGCTTTAACAAGAAAGG - Intergenic
1081255082 11:40882777-40882799 CTCTTTTTCTTGAAATAAAATGG + Intronic
1082172629 11:49024569-49024591 CTGTTGTTTATAAACAAAAATGG + Intergenic
1083108750 11:60384237-60384259 CTTTTCATTTTGAGCAAAAAAGG - Intronic
1083322957 11:61858493-61858515 CTTTTTTTCTTCACCAAAAGTGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1086448246 11:86890370-86890392 CTTTTGTTCTGGCATAAAGATGG - Intronic
1087220802 11:95544318-95544340 CTTTAGGTCTAGAACAGAAAGGG - Intergenic
1088401490 11:109425277-109425299 CTTTTTTTTTTTTACAAAAAAGG - Exonic
1090591551 11:128275523-128275545 CTTTTGTTTTTGGACCATAATGG - Intergenic
1091386312 12:97995-98017 CTTTTGTTGTTTTACAAAATAGG + Intronic
1091430889 12:433387-433409 ATTTTGTACTTGAACAACAGCGG + Intronic
1092328433 12:7559692-7559714 CATTTGTTATTGAAGAAAAGTGG + Intergenic
1092441956 12:8512299-8512321 TTTTTGTTCTGGAACTAAATGGG - Intronic
1093135505 12:15445126-15445148 CTCTTGTTCTTTAATAAAAGTGG - Intronic
1093658059 12:21720526-21720548 TTTTTGTTGCTGAAAAAAAATGG + Intronic
1093869591 12:24272441-24272463 GTCTTGTTCTTGAACACAGAAGG + Intergenic
1094178223 12:27563785-27563807 TTTTTGTTTTTTAACATAAAGGG + Intronic
1094614931 12:32028047-32028069 GATTTATTCTTGAACAAGAAGGG - Intergenic
1094809278 12:34122164-34122186 CTTTTTTTCTTGGCCAATAACGG + Intergenic
1094822994 12:34241625-34241647 CTTTGTTTCTTTAACAAGAATGG - Intergenic
1095386502 12:41657061-41657083 CTTTTTTTTTTAAACAAAACAGG - Intergenic
1095655075 12:44659774-44659796 TTTTTGTTGTTGAAAAAAAAGGG - Intronic
1095678000 12:44942197-44942219 AGTTTGTTCTTCATCAAAAATGG + Intergenic
1097329773 12:58320001-58320023 ATTTTGTAATTGAACAAAAGGGG + Intergenic
1097368355 12:58744750-58744772 TTGTTTTTCTTTAACAAAAAGGG - Intronic
1097420703 12:59375352-59375374 ATTTTGTTCTTCAAGAAATAGGG - Intergenic
1097495007 12:60320783-60320805 CATTTGTTTTTTAACCAAAAAGG + Intergenic
1097751111 12:63353872-63353894 ATTTTCTTCTTGTACAAAATAGG - Intergenic
1098077148 12:66744262-66744284 CTTCTATTCCTGAAAAAAAAAGG + Intronic
1098554862 12:71806781-71806803 CTTTTGTTTTGGAACTTAAAAGG - Intergenic
1099171507 12:79370425-79370447 CTTTTGTTTGGGAACTAAAATGG - Intronic
1099307528 12:80976548-80976570 GTTTCGTTCTTGAAGAAAATTGG - Intronic
1099335327 12:81348902-81348924 ATTTTGTTCTTGATTACAAATGG + Intronic
1099456447 12:82868704-82868726 TTTTTTTTTTTGAAAAAAAAAGG + Intronic
1101273607 12:103175205-103175227 ATTTTATTCTTGAATAAAACTGG - Intergenic
1101363583 12:104050547-104050569 TTTTTGTGCCTGAACAAAAGAGG + Intronic
1101365831 12:104069515-104069537 TTTTTTTTTTTTAACAAAAAAGG - Intronic
1101383299 12:104233289-104233311 TATTTATTCTTTAACAAAAAGGG + Intronic
1102341202 12:112122867-112122889 ATTTTATTCCTGACCAAAAAAGG - Intergenic
1104357033 12:128095959-128095981 CTTTAGTTCTGGAAGAAAACAGG - Intergenic
1104751438 12:131242556-131242578 GATTTGTTCTTTAACAAGAAGGG + Intergenic
1105991372 13:25625265-25625287 CATTTGTTCTTCCTCAAAAAGGG - Intronic
1106078466 13:26481134-26481156 CTTTGGTTCATTTACAAAAATGG - Intergenic
1106206265 13:27598373-27598395 TTTTTGTTATTAAACAAAAGGGG + Intronic
1106691017 13:32116746-32116768 CATTTGTTCTTTAAAGAAAAAGG + Intronic
1107393209 13:39988940-39988962 CTTTTGTTCTTAGAAAAATAAGG + Intergenic
1107922261 13:45221333-45221355 CTTATATTCTGGAGCAAAAATGG - Intronic
1108132850 13:47322031-47322053 CTTTTAATCTTGCACAAAAATGG - Intergenic
1108135486 13:47352880-47352902 TTTTTTTTCTGGAACATAAATGG + Intergenic
1108764351 13:53608472-53608494 CTTTAGCTCTTGAATAAAATCGG - Intergenic
1109240546 13:59882008-59882030 ATTTTGTTGTTAAATAAAAAGGG - Intronic
1109879657 13:68454402-68454424 TTTTTGTTGTTGTACAAAATAGG - Intergenic
1110913170 13:80989533-80989555 CTATTGTTATTGAACCAAACTGG + Intergenic
1113022376 13:105902080-105902102 CTTTTTTTTTTTAATAAAAAAGG - Intergenic
1114779613 14:25523425-25523447 CTTTTGTTATTAATCAAGAAAGG + Intergenic
1115880699 14:37914440-37914462 CTTTTGTTTTTCAAGGAAAAAGG + Intronic
1116478248 14:45366303-45366325 CTTTTATTTTTGAACAAACGGGG + Intergenic
1116553188 14:46268797-46268819 CTTTTTTTCTTAAACCAATAAGG - Intergenic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117459570 14:55931639-55931661 CATTTCTTCTTTAAAAAAAAAGG - Intergenic
1117514914 14:56491454-56491476 CTTTTGTCATTGAACAGACATGG - Intronic
1117709857 14:58516303-58516325 CTTTTGTTCTTAAAGGAGAAGGG - Intronic
1118523458 14:66614747-66614769 CTTTATTTCTTGTAAAAAAATGG + Intronic
1119633423 14:76254100-76254122 CTTTTCTTCTTGTATAAAATGGG - Intronic
1119902315 14:78271994-78272016 TGTTTGTTCTTGAAGAAGAAGGG + Intronic
1120330101 14:83081803-83081825 CTTTTGCTCTTTAAAAAAAGGGG + Intergenic
1120727780 14:87964639-87964661 CTTTTGTGTTTCAATAAAAACGG + Intronic
1121964653 14:98292811-98292833 ATTTTTTTCTTAAACAAAGAGGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1123736778 15:23192462-23192484 CTTTTGTTCTAGTTCAAAGAAGG + Intergenic
1124069312 15:26376808-26376830 GTTTTTTTCTTGAATAAACATGG - Intergenic
1124287477 15:28415440-28415462 CTTTTGTTCTAGTTCAAAGAAGG + Intergenic
1124287999 15:28421142-28421164 CTTTTGTTCTAGTTCAAAGAAGG + Intergenic
1124295226 15:28496185-28496207 CTTTTGTTCTAGTTCAAAGAAGG - Intergenic
1124513480 15:30347345-30347367 CTTTTTTTCTGGAACCAAGATGG - Intergenic
1124801423 15:32836631-32836653 CTCTTGTTCTTCACCAAACAAGG - Intronic
1125339923 15:38664820-38664842 TTTTTGTTCTTGTACATAAATGG - Intergenic
1126869761 15:52975445-52975467 CTTCTGGTCTTTAACAAATAAGG + Intergenic
1127139176 15:55956279-55956301 CTTTTCTTCTTTAAGAAACAAGG - Intronic
1127371015 15:58341304-58341326 CTTGGATTCTTGAACGAAAATGG - Intronic
1128604842 15:69028834-69028856 CTTTTTTTTTTTAACAAAATGGG + Intronic
1128839409 15:70837564-70837586 CTTTTATTCTTTAATAAATATGG - Intronic
1129290936 15:74567015-74567037 ATTTTTTTTTTCAACAAAAATGG + Intronic
1130453224 15:84078587-84078609 ATTTTTTTTTTTAACAAAAAAGG - Intergenic
1130570895 15:85042660-85042682 CTTTGGTTCTAGAACAAAGAAGG - Intronic
1131499715 15:92950300-92950322 TATTTATTCTTTAACAAAAAGGG + Intronic
1132189975 15:99845975-99845997 GTTTTGTTTTTGTAGAAAAAGGG + Intergenic
1133847625 16:9470179-9470201 CTTTTGTTCTTGACAATGAATGG - Intergenic
1135041546 16:19121260-19121282 TTTTTGCTTTTGAAAAAAAAAGG + Exonic
1135930852 16:26735248-26735270 CATCTGTTGTTGAACAAAACTGG + Intergenic
1136557976 16:31019870-31019892 CTTTTGTTCCTGAGCACAACAGG + Intergenic
1137415128 16:48269690-48269712 CATTTGTTTTTTAAAAAAAAGGG - Intronic
1137641476 16:50034455-50034477 TGTTTGTTATTGACCAAAAATGG + Intronic
1137663890 16:50236499-50236521 CTTTTATCCTTTAACACAAATGG + Intergenic
1137817788 16:51415589-51415611 TTTTTTTTTTTGAAAAAAAAAGG + Intergenic
1137989379 16:53137787-53137809 TTTATGTTCTTGAAGATAAATGG + Intronic
1138477490 16:57280488-57280510 CTTTTGGTTTTAAAAAAAAAAGG - Intronic
1138569367 16:57859057-57859079 CTTTGGTTTTATAACAAAAAAGG + Intronic
1139169098 16:64609576-64609598 CTTTAGTTCTTCTAAAAAAATGG + Intergenic
1139396781 16:66646156-66646178 TTTTTGTTCTTCACCAAAAATGG - Intronic
1140258765 16:73359189-73359211 TTTTTTTTTTTAAACAAAAAGGG + Intergenic
1140397501 16:74640984-74641006 CTTTTCTTGTTTAAAAAAAAAGG - Intronic
1141723455 16:85769998-85770020 CTTTTGTTCATTAAAAAACAGGG - Intergenic
1141783807 16:86184650-86184672 CTTGTGTTCTTACACATAAATGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144747546 17:17625946-17625968 ATATTGTTCTTAAAAAAAAAAGG - Intergenic
1146099837 17:29970453-29970475 CTTGTCTACTTGAAAAAAAATGG + Intronic
1146125384 17:30227354-30227376 GTTTTTTTTTTGGACAAAAAGGG + Intronic
1146250768 17:31341855-31341877 CTTTTGTCTTTGGATAAAAATGG + Intronic
1146525052 17:33560038-33560060 CTTTGGTGATTGAAAAAAAATGG - Intronic
1148097828 17:45066017-45066039 CTTTAGTTCCTGAAAAAAAGGGG - Intronic
1148925128 17:51077485-51077507 TTTTCTTTCTTGAACAGAAAAGG + Intronic
1149041694 17:52197377-52197399 CTTTTGTTATTGCAAAAGAAAGG - Intergenic
1149153903 17:53603284-53603306 TTGATGTTCTTAAACAAAAACGG - Intergenic
1149234614 17:54575292-54575314 TTTTTCTTCTTTAACCAAAATGG - Intergenic
1149903177 17:60500782-60500804 CTTTTTTACTTAAACAAAACTGG + Intronic
1150091306 17:62328033-62328055 CTTTTGTTCCTTAAGAAATAAGG - Intergenic
1150263640 17:63817524-63817546 CTTTTGTTCTTGTGCTATAAAGG - Intronic
1150461074 17:65353084-65353106 CTTTTATTTTTGATCATAAATGG - Intergenic
1153379134 18:4416406-4416428 CTTTTATTCATGAAAAATAAAGG + Intronic
1153594299 18:6708949-6708971 CTCTTGTTTTTCAATAAAAAAGG - Intergenic
1153807568 18:8722384-8722406 CTTTTTTTCTTTAAGAAACAGGG - Intronic
1155107524 18:22682286-22682308 CTTTCCTCATTGAACAAAAATGG + Intergenic
1155226119 18:23730673-23730695 CTTTTTTTCTTAAACAAAATGGG + Intronic
1155785484 18:29894325-29894347 ATTTCTTTCTTGTACAAAAATGG - Intergenic
1155992851 18:32298402-32298424 CTTTTGCTATTAAAAAAAAAAGG - Intronic
1156056499 18:33011331-33011353 CTTTAGTTATTGCAGAAAAAAGG - Intronic
1156177936 18:34569362-34569384 CTTTTCCTCTTAAACAGAAAAGG + Intronic
1156205741 18:34883646-34883668 ACTTTGTTATTGAAAAAAAAGGG + Intronic
1156650119 18:39215800-39215822 CTTTTTTTTTTTGACAAAAAGGG - Intergenic
1156850553 18:41720739-41720761 TTTTTGGTCATGAAGAAAAATGG - Intergenic
1157085436 18:44575952-44575974 TTTTTTTTCTGGAACAAAATAGG + Intergenic
1158173838 18:54630912-54630934 CATTTTTTTTTAAACAAAAAGGG + Intergenic
1158383142 18:56958032-56958054 CTTTTAATCTTTATCAAAAATGG - Intronic
1158842797 18:61406175-61406197 CCTTCATACTTGAACAAAAATGG - Intronic
1159013948 18:63086200-63086222 CATTTGTTCTTGGACTTAAATGG + Intergenic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1159603436 18:70450746-70450768 ATTTTCTTCTTAAAAAAAAAAGG - Intergenic
1159627051 18:70707365-70707387 CTTTTATACTTGAACACATATGG + Intergenic
1160296947 18:77647521-77647543 ATTTTGTGGTTGAACAAAGAAGG - Intergenic
1161665252 19:5572018-5572040 TTTTTGTTTTTGAGCAAACAGGG + Intergenic
1164373255 19:27659852-27659874 CATTTGTTATTTAACAAGAAGGG + Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164897380 19:31888647-31888669 TTTTTTTTTTTTAACAAAAATGG + Intergenic
1165197331 19:34114881-34114903 CCTTTGTACTTAAAAAAAAAAGG - Intergenic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167118796 19:47504080-47504102 CTTTTTTTTTTAAACACAAATGG - Intronic
1168487683 19:56778558-56778580 TTTTTGTTCCTGTACAAAAAAGG - Intronic
926174875 2:10581844-10581866 CTTTTTTTCTTTAACATGAATGG - Intronic
926372438 2:12193375-12193397 CTCTTCTGGTTGAACAAAAATGG - Intergenic
928255462 2:29718484-29718506 CCTTCCTTCTTTAACAAAAAAGG - Intronic
928786787 2:34897273-34897295 CTTTTTTTCTTGAAAAATAGTGG + Intergenic
928992525 2:37249105-37249127 TTTTTCTCCTTCAACAAAAATGG - Exonic
929067924 2:37998787-37998809 CTTTTTTTGTTGTATAAAAAGGG + Intronic
929068381 2:38003663-38003685 TTTTTGTTCTTGAAAAGAAAAGG + Intronic
929203174 2:39259764-39259786 CTTTTTTTCTTCAAACAAAAGGG - Intronic
929302060 2:40316236-40316258 CTTATGTCCTTGAACCACAAAGG - Intronic
929618705 2:43333511-43333533 CTTTTTTTCTTTCAAAAAAAAGG - Intronic
930257151 2:49105472-49105494 CTTTTGTGCTTAAAAAACAAAGG + Intronic
930417424 2:51106258-51106280 ATTCTCTTCTTGAACAAAATTGG + Intergenic
930579214 2:53189559-53189581 CTTTTACTCATGGACAAAAATGG + Intergenic
931956374 2:67430435-67430457 CTTTTTTTTTTCAATAAAAAAGG + Intergenic
932018431 2:68057461-68057483 CTTTTTTTCTTCAAAATAAATGG - Intronic
932684490 2:73856713-73856735 CTCCTGTTCTTGAACCAAATTGG - Intronic
932747211 2:74343948-74343970 CTTTTTCACTTAAACAAAAATGG - Intronic
932795816 2:74695087-74695109 ATTTTGTTTTTGAACTAAAATGG + Intergenic
932879294 2:75485752-75485774 CTTTTCTTCTTGAACTGCAATGG - Intronic
932908938 2:75785087-75785109 CTTTTTTTCTAAACCAAAAATGG + Intergenic
933004245 2:76970281-76970303 CTTTTGTCTGTGAACAAAATAGG - Intronic
933069449 2:77838706-77838728 CTTTGGTTCTTGAGCTAGAAAGG + Intergenic
936001362 2:108833578-108833600 CATTTGTCCTTTTACAAAAAAGG - Intronic
936347255 2:111684556-111684578 CTTTTTTTCTACAAGAAAAATGG + Intergenic
937677077 2:124603181-124603203 CTTAGTTTCTTCAACAAAAATGG - Intronic
940343789 2:152608350-152608372 CTTTTTTTTTTTCACAAAAAGGG - Intronic
940759561 2:157722468-157722490 CTTTTTTTTTTTAAAAAAAAAGG + Intergenic
941130724 2:161647629-161647651 CTTGTGTTCTTAGAGAAAAAAGG + Intronic
941764325 2:169280240-169280262 CCTTTGTTTTCTAACAAAAAAGG - Intronic
941797321 2:169613973-169613995 CTGTTGGACTTGAACAGAAATGG - Intronic
942418351 2:175782056-175782078 GTTTTGTTTTTTAACAAAACGGG + Intergenic
943044219 2:182839356-182839378 ATTTACTTCTTGAATAAAAATGG + Intronic
944148695 2:196534268-196534290 TTTTTTTTCCTGCACAAAAACGG - Intronic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
944301071 2:198125534-198125556 CTCTTGTACTTGAAAAAAAATGG - Intronic
945450161 2:209985039-209985061 CATATGTTCATGAACAACAAAGG - Intronic
945571906 2:211478815-211478837 GTTTTGTTTCTGAAGAAAAAAGG - Intronic
946902867 2:224389311-224389333 CTTTTGTTATTGAACTGAGACGG + Intronic
948982575 2:241501861-241501883 GTTTAGTTTTTGAACAAAAAGGG - Intronic
1169245044 20:4018479-4018501 CTTTTGTTCTTGAAAAAATTAGG + Intergenic
1169702179 20:8459109-8459131 CTATTGTTTTTCTACAAAAATGG - Intronic
1169708157 20:8531390-8531412 ATTTACTTTTTGAACAAAAATGG + Intronic
1170739020 20:19037142-19037164 TTTTTGTTCCTGAAACAAAAAGG + Intergenic
1171345060 20:24459729-24459751 CCTTTCTTCTTCAGCAAAAAAGG + Intergenic
1171363815 20:24610002-24610024 CTTTTCCTTTTGACCAAAAAGGG - Intronic
1171442483 20:25176528-25176550 CCTTAGATCATGAACAAAAAGGG - Intergenic
1172855317 20:37997241-37997263 TTTTTTTTTTTTAACAAAAATGG - Intronic
1172995793 20:39069634-39069656 TTTTTTTTTTTTAACAAAAACGG - Intergenic
1173036551 20:39417028-39417050 ATTTTTTTCTTTAAGAAAAATGG + Intergenic
1175884571 20:62282047-62282069 ATTTTGTTATTGAGCATAAAAGG + Intronic
1177233732 21:18358524-18358546 CATTTGCTCTTAAAAAAAAATGG - Intronic
1177879810 21:26678851-26678873 CTTGAGTTCTTAAAGAAAAAAGG - Intergenic
1182055148 22:27347049-27347071 TTTTTTTTCTTAAACAACAATGG - Intergenic
1184304848 22:43590809-43590831 CTCTTTTTCTTGAGCAAAGATGG + Intronic
1184674259 22:46031981-46032003 CTTTGGTTCTTAAAACAAAACGG + Intergenic
1184940896 22:47764081-47764103 CTTTTTTTTTTTAAAAAAAAGGG - Intergenic
949176780 3:1073026-1073048 ATTTTGTTAATAAACAAAAATGG - Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
949858673 3:8485601-8485623 TTCTTGTTCTTGTACAAACAAGG + Intergenic
950261912 3:11548597-11548619 CTTTTTTTCTTAAACAAAGGTGG + Intronic
950875883 3:16272332-16272354 TTTATGTTTTTAAACAAAAATGG - Intronic
951791510 3:26490630-26490652 CTCTTGATTTTCAACAAAAATGG + Intergenic
951862165 3:27265159-27265181 GTTTTGTTTTTGAACTTAAAAGG - Intronic
951963780 3:28358700-28358722 CCTTTGTACTTGAAATAAAAAGG + Intronic
953611074 3:44447820-44447842 CATATGTTCTTGAACATCAAAGG - Exonic
955780830 3:62482879-62482901 CTTTTGTTTTTGGACAAAGATGG + Intronic
956020392 3:64927627-64927649 TTTTTTTTTTTTAACAAAAAGGG + Intergenic
956156225 3:66300674-66300696 CTTTTTTTCATGAAGCAAAAAGG - Intronic
956189166 3:66592218-66592240 CCTTTGTTTTTGAACAAGAGGGG - Intergenic
956490287 3:69764033-69764055 CTTTGGTTCTTGTTCATAAATGG + Intronic
957361836 3:79170045-79170067 CTCTTGGTCTTTAACAACAAAGG + Intronic
957717782 3:83953409-83953431 CTATTGTTCTTAAACATAAAAGG - Intergenic
959204324 3:103284983-103285005 ATTCTATTCTTGAACAAAACTGG + Intergenic
959526028 3:107378342-107378364 CTTTTGTTCATGGAGGAAAATGG + Exonic
959721179 3:109491129-109491151 CTTTTCTGCTTGAACCAAAGAGG - Intergenic
962300401 3:134236548-134236570 CTTTTACTCTTGTGCAAAAATGG - Intronic
962317180 3:134366206-134366228 CTTTTGTTCTAGAGAAAAATTGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964374772 3:156038516-156038538 GTTTTTTTCTTGAACACATATGG + Intronic
965467917 3:169055392-169055414 CTCCTGGTCTTGAACAAAACAGG - Intergenic
965729521 3:171755931-171755953 GTTTTCTTCTTGAAGAAAATTGG + Intronic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
965902997 3:173667382-173667404 ATTTTGGACTTGAAGAAAAATGG + Intronic
966014572 3:175125672-175125694 CTTCTATTCTTGTACAAAATAGG - Intronic
966067817 3:175837521-175837543 CTTTTGGCCTTGAAGAAGAAAGG - Intergenic
966283520 3:178265021-178265043 TTTTTATTCTAAAACAAAAATGG + Intergenic
966304630 3:178517273-178517295 CTTTGTTTCTGAAACAAAAATGG + Intronic
966354145 3:179061048-179061070 TTTTTTTTCTTGAAATAAAATGG - Intronic
968792174 4:2673259-2673281 CTTTTGAGCTGGAACAGAAAGGG + Intronic
969551821 4:7873917-7873939 CTTTTGTTCTTGGCCACAAATGG - Intronic
969891608 4:10264992-10265014 CTTTTGTACCAGAACAAAAGTGG + Intergenic
969894872 4:10294160-10294182 CTTTTGTACTGGAACAAAAGTGG + Intergenic
970150469 4:13083715-13083737 TTTTTTTTATTTAACAAAAATGG - Intergenic
970795530 4:19908224-19908246 CTTTTCTTCCAGAACACAAAGGG - Intergenic
970912136 4:21289512-21289534 TTTATTTTCTTGAATAAAAAAGG - Intronic
971179932 4:24320299-24320321 CATTTATTCTAGAATAAAAAAGG - Intergenic
971401226 4:26277263-26277285 TTTTTTTTTTTGAACAAACAGGG - Intronic
972052446 4:34755466-34755488 ACTTTGTTCTTTAAAAAAAAAGG + Intergenic
972703887 4:41521308-41521330 CATTTTTTCTTCTACAAAAATGG + Intronic
973060309 4:45716052-45716074 TGTTTGTTTTTCAACAAAAATGG + Intergenic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974650944 4:64753648-64753670 CTTATTTTCCTGAACATAAAAGG - Intergenic
975359017 4:73444860-73444882 CTTTTCTTTTTAAACAACAAGGG + Intronic
975400787 4:73936990-73937012 CTTTCATTCTTCAACAAAAAGGG - Intergenic
975694848 4:77001964-77001986 CTTTTTTTCTTTAACAGACAGGG - Intronic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976480282 4:85535205-85535227 TTTCTTTTCTTTAACAAAAAAGG - Intronic
977362552 4:96024812-96024834 CTTATGTCATTGAACCAAAAAGG + Intergenic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
978295272 4:107197559-107197581 TTTTTTTTCTTGAAGATAAATGG - Intronic
978386797 4:108184250-108184272 TTTTTTTTCTTCAATAAAAAAGG - Intergenic
978776396 4:112510461-112510483 CTTTTATTCTTAAAAAAAATGGG - Intergenic
979580702 4:122355952-122355974 CTGTGGTTCTTGAACATGAATGG - Exonic
980119687 4:128714868-128714890 CATTTGTTCTAGAAGAATAAAGG + Intergenic
980235702 4:130103004-130103026 ATTTAGTGCTTCAACAAAAATGG - Intergenic
980316791 4:131211240-131211262 CTTTTATGCTTGAATCAAAATGG + Intergenic
982357040 4:154482384-154482406 TTTTGGTTCTTGAGCAAAAGTGG - Intronic
982789426 4:159573778-159573800 ATTTTGTTCACGAACAAAAAGGG + Intergenic
983034540 4:162847319-162847341 CTTTGGTTCTTGTTCAAAATTGG - Intergenic
983653003 4:170052238-170052260 CTTTTGTTCGCAAATAAAAATGG + Intergenic
983889242 4:173014035-173014057 CTTTTTTTTTTGGAAAAAAACGG - Intronic
984023101 4:174510210-174510232 CAGTAGCTCTTGAACAAAAAAGG + Intronic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984182609 4:176503230-176503252 CTTTGTTTCTTCAAGAAAAATGG - Intergenic
984805803 4:183750527-183750549 CTTATGTTCTTGGACCATAATGG - Intergenic
985077335 4:186229014-186229036 CTTTTTTCCTGGAAAAAAAAAGG - Intronic
985249143 4:188005710-188005732 CATTTGCTGTTGAACAAAAGTGG - Intergenic
986032584 5:3908245-3908267 CTTTTGATCTTGAACAAACTAGG + Intergenic
986384368 5:7217173-7217195 CTCTTGTTTCTGAAAAAAAATGG - Intergenic
987227967 5:15863342-15863364 TTTTTCTTCTTAAATAAAAATGG - Intronic
988426298 5:31068778-31068800 TTTTTATTCTTGCAGAAAAATGG - Intergenic
988437022 5:31188351-31188373 CCTTTTATCTTGAACACAAATGG + Intergenic
988463980 5:31469793-31469815 TTTTTATTCTTAAACAAAGATGG - Intronic
988988518 5:36645634-36645656 CTTTTGACCATCAACAAAAAAGG + Intronic
990275868 5:54195735-54195757 CTTTTCTTTTAGTACAAAAATGG + Intronic
990906786 5:60812421-60812443 CTATTGTTATTGAACAACATAGG - Intronic
991095439 5:62734968-62734990 CTTTTGCTAATAAACAAAAATGG + Intergenic
991558618 5:67924503-67924525 TTTTCCTTCTTGAAAAAAAAGGG - Intergenic
993299579 5:86191185-86191207 CTTGTGTTCTAGTAGAAAAATGG - Intergenic
993394398 5:87365458-87365480 CATTTCTGCTTGAACATAAAAGG - Intronic
993689536 5:90982388-90982410 CTTTTGGTTTTTAAAAAAAATGG + Intronic
993811322 5:92480881-92480903 GTCTTGTTCTTGACCTAAAAGGG - Intergenic
994439132 5:99779946-99779968 CTGTTGTCCTTGAACAAGCAAGG - Intergenic
994455679 5:100004252-100004274 TTGTTTTTCTTTAACAAAAATGG + Intergenic
995655051 5:114416992-114417014 CTCCTGTTTTTGAACAAAACTGG + Intronic
996050476 5:118926685-118926707 CTTTCTTTTTTGAACAAAAGGGG - Intronic
996077426 5:119213341-119213363 GTTCTGGCCTTGAACAAAAAGGG - Intronic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
996760479 5:126981720-126981742 CCTTTTTTCTTAAACAACAAAGG + Intronic
996760478 5:126981720-126981742 CCTTTGTTGTTTAAGAAAAAAGG - Intronic
997156103 5:131559821-131559843 CTTTTTTTCTTAAAGAAAAGGGG - Intronic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
997726391 5:136123750-136123772 CTTTTGCACTCTAACAAAAATGG - Intergenic
998360739 5:141584448-141584470 CTTTTTTTCTCTAAGAAAAATGG + Intronic
998579107 5:143351469-143351491 CTTTTTTTCCTCAACAAAAGAGG - Intronic
999030708 5:148288006-148288028 CTATTCTCCTTGGACAAAAAAGG - Intergenic
999991892 5:157057616-157057638 CCTTTGTGTTTAAACAAAAAGGG - Intronic
1000533884 5:162456785-162456807 CTTTAGCTCCAGAACAAAAAAGG - Intergenic
1001073728 5:168608297-168608319 TTTTTGTTTTTGAAAAAACAAGG + Intergenic
1001167927 5:169388225-169388247 CATTTTTTCATGAAAAAAAATGG + Intergenic
1002233356 5:177784450-177784472 CTTTTTTTTTTTAAAAAAAAAGG + Intronic
1002391770 5:178919162-178919184 TTTTTGTTTTTGAACACGAATGG + Intronic
1002683062 5:180983769-180983791 CTTTTGTTCTTCGACTCAAATGG + Intergenic
1003220444 6:4156542-4156564 CTTTTATTCTTCCACAAAACTGG - Intergenic
1004589355 6:17033617-17033639 ATTATGTTTTTAAACAAAAAAGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1006348281 6:33501326-33501348 ATTTTGTTTATGTACAAAAAAGG + Intergenic
1006778032 6:36611437-36611459 TTTTTTTTTTTTAACAAAAAAGG - Intergenic
1007801726 6:44400146-44400168 CTTTTGTTCTTGGAACATAATGG + Intronic
1007945356 6:45821712-45821734 CTTATATTCTTGAACATAGAAGG - Intergenic
1007996197 6:46310786-46310808 CTTTTATTCCTTCACAAAAATGG + Intronic
1008275456 6:49539145-49539167 CTTTCGTTCTAGGAAAAAAAAGG + Intergenic
1009861278 6:69336488-69336510 CTTTTTTTCTTTAAAGAAAAAGG + Intronic
1009925579 6:70116650-70116672 TTTTTTTTCTTGAATACAAAGGG + Intronic
1010394488 6:75375053-75375075 CTATTGTCCTTCAACCAAAATGG - Intronic
1010452862 6:76022052-76022074 TTTTTGTTCTTTAGCAAAACAGG - Intronic
1010706140 6:79113176-79113198 CTTATGTTCTGGAAGCAAAAAGG - Intergenic
1011279087 6:85658810-85658832 TTTTGGTTCCTGAACAATAAGGG + Intergenic
1013839107 6:114368983-114369005 CTTTTTTTTTGGAAAAAAAAAGG - Intergenic
1014429660 6:121353111-121353133 CTATTTTTTTAGAACAAAAAAGG + Intergenic
1014784491 6:125602123-125602145 CTTGGGTACTTTAACAAAAATGG - Intergenic
1016127309 6:140420366-140420388 CTTTTGTTCATTTTCAAAAAGGG + Intergenic
1016488089 6:144565504-144565526 GTTTGGTGATTGAACAAAAAAGG + Intronic
1016774110 6:147885415-147885437 ATTTTGTTTTTAAAGAAAAAAGG - Intergenic
1021143735 7:17059526-17059548 ATTTTGTCCTTGAATATAAAAGG - Intergenic
1021409285 7:20311023-20311045 CTTTTTTTCTAGAACTGAAAGGG + Intergenic
1021900604 7:25281257-25281279 CTTTTGCTTTTGGCCAAAAAGGG + Intergenic
1021983781 7:26080066-26080088 CTTTTTTTCTTCCCCAAAAAAGG + Intergenic
1022404916 7:30079867-30079889 ATTTAGTTCTTGAAGAAAACTGG - Exonic
1022596937 7:31721796-31721818 CTTTTGTGGTTGCACAAAGAAGG + Intergenic
1023452202 7:40298977-40298999 CTTTTGTGCTTGAATAACAATGG + Intronic
1024301774 7:47892464-47892486 CTTTTACTCTTGAGTAAAAAGGG + Intronic
1024375189 7:48629523-48629545 TTTTTGTTCTTTTATAAAAATGG - Intronic
1024435151 7:49343436-49343458 CTGGAGTTCTAGAACAAAAAGGG + Intergenic
1024972504 7:55083678-55083700 TTTTTCTTCCTGAAAAAAAATGG + Intronic
1026011685 7:66641147-66641169 CTATTGTTCTCGTACACAAAGGG + Exonic
1026560957 7:71448659-71448681 CATTTTTTCTTGAAAACAAAAGG + Intronic
1026688407 7:72532376-72532398 CATTTGTACCTGAACAAACATGG + Intergenic
1026723642 7:72854259-72854281 CATTTGTACCTGAACAAACATGG + Intergenic
1027487822 7:78783983-78784005 CTTTTTTTCCTGATTAAAAAAGG - Intronic
1027969677 7:85062745-85062767 CTTTTAATCTAGAATAAAAATGG + Intronic
1028112687 7:86961656-86961678 CATTTATTCTTGAAGAACAATGG - Intronic
1029562909 7:101315483-101315505 CTTCTGTTCTTAAACCAGAAAGG + Intronic
1029867126 7:103645281-103645303 ATATAGTTCTTGAACAGAAATGG + Intronic
1030861755 7:114640305-114640327 CTTTTTTTATGGAAAAAAAATGG + Intronic
1031225697 7:119035220-119035242 CTTTTTTCCTTAAAAAAAAAAGG - Intergenic
1031504254 7:122561332-122561354 CTTTTTTTTTTAAACAAGAAAGG + Intronic
1031619897 7:123923478-123923500 TTTTTGTTCATGAACAACACTGG - Intergenic
1032157604 7:129481861-129481883 CTTTTGTTTTTTAACACAAATGG - Intronic
1034656494 7:152733948-152733970 TATTTATTCTTTAACAAAAAGGG + Intergenic
1034842982 7:154416991-154417013 CTTTTTGTCTAGAACCAAAAAGG - Intronic
1034855965 7:154547567-154547589 CTTTTGTTCCTGAACTAAAAGGG - Intronic
1036122047 8:6029296-6029318 CTTTTGCTGTTGCATAAAAAAGG - Intergenic
1036421398 8:8599279-8599301 TTTTTGTTATTTAAAAAAAATGG - Intergenic
1037430530 8:18808376-18808398 CTCTTGTATTTGAACAAAATTGG - Intronic
1039123244 8:34172323-34172345 ATTTTGTTCTTTTAAAAAAAAGG - Intergenic
1039241864 8:35566108-35566130 CTTTTGTGCTTTCACAAACAGGG + Intronic
1039553559 8:38460598-38460620 CTCTTGTTCTTTCCCAAAAAAGG + Intronic
1039662544 8:39482884-39482906 CTCTTGCTCATGAACAAAAAGGG - Intergenic
1039849215 8:41347811-41347833 CTTTTTTCCTTGAACAAGAGTGG - Intergenic
1040666212 8:49636684-49636706 TTTTTGTTTTTTAAAAAAAAAGG - Intergenic
1040908897 8:52498154-52498176 CTTCTCTCCTTGAACAAAAGGGG - Intergenic
1041204964 8:55489587-55489609 CTTTTGTTATTTAAAAAAAAAGG + Intronic
1041451996 8:58015420-58015442 CATTTGTTTTTCAACAAAAATGG + Intronic
1041498934 8:58518644-58518666 CTTTTGTGTTTGATTAAAAATGG + Intergenic
1041586160 8:59522354-59522376 CATTTGTTCTTGAAAAGAAAGGG - Intergenic
1041737216 8:61123991-61124013 GTTTTGTTCTTGCACAACAAAGG + Intronic
1042233589 8:66585367-66585389 ATTTTCTTCTTTCACAAAAAAGG - Intronic
1042945463 8:74149863-74149885 CCTTTGATCTTAAACATAAAGGG - Intergenic
1043037820 8:75219555-75219577 CTTCAGTACTTGAACAAATATGG - Intergenic
1043136796 8:76537541-76537563 CTTTTTTTTTTTAAAAAAAAAGG + Intergenic
1043521653 8:81052824-81052846 CTGTTGTTCTTGGAAAACAAAGG + Intronic
1043645759 8:82516685-82516707 CTTGTGTTCTTGTATGAAAATGG - Intergenic
1043840542 8:85098563-85098585 CATTTTTTCTGGAACAGAAAAGG - Intergenic
1043883066 8:85566949-85566971 ATTTTGGTCTTCAAAAAAAAGGG - Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044189696 8:89300424-89300446 GTTTTGGTTTTTAACAAAAAAGG + Intergenic
1044720987 8:95146204-95146226 GTTTTCTTCTTTAAAAAAAAAGG + Intronic
1045144276 8:99322391-99322413 CTTGAGTTCTTGAAAACAAACGG - Intronic
1045550800 8:103170465-103170487 CTGTTGTTCTTGTAAGAAAAAGG + Intronic
1045990153 8:108297305-108297327 ATTTTGCCCTTGAACTAAAAAGG + Intronic
1046112566 8:109743691-109743713 CTTTCCTTCTTAAACAGAAATGG + Intergenic
1046434520 8:114169661-114169683 CTTTTGTTCTCAAATAAGAAGGG - Intergenic
1047103809 8:121710954-121710976 CTTTGGTTCTTCAAGAAATAGGG - Intergenic
1047659892 8:127021789-127021811 TTTGTGTTTTTGAACAAATAAGG + Intergenic
1048131381 8:131701532-131701554 TTTTTGTTCTTGATCCAAAATGG - Intergenic
1050198938 9:3120720-3120742 CTTTTGCTATTGAACAAAAATGG - Intergenic
1050342758 9:4657056-4657078 ATTTTCTTCTTGAAACAAAAGGG + Intronic
1050945073 9:11506976-11506998 CTTTTTTTCTTTAATAGAAATGG + Intergenic
1051200651 9:14618697-14618719 CTTTTGTTATTAAACTCAAAAGG - Exonic
1051892578 9:21958767-21958789 CTTTTTCTCTTGTACAAGAAAGG - Intronic
1051894428 9:21973466-21973488 TTTTTGTTTTTAAACAAATAAGG + Intronic
1052457983 9:28725458-28725480 CTTTTATTCGTGAATAAGAACGG - Intergenic
1053268050 9:36730292-36730314 CTTTTGTTTGAGAAAAAAAAAGG - Intergenic
1053269279 9:36739273-36739295 CTTTTTATCTTGAGCAACAAAGG + Intergenic
1053315821 9:37050737-37050759 CTTTTGTTTTAAAACAAAGAAGG + Intergenic
1053491777 9:38512175-38512197 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1054739082 9:68786743-68786765 TTTTTGTTTTAGAACGAAAAGGG + Intronic
1054977677 9:71167043-71167065 TGTTTGTTTTTGTACAAAAATGG - Intronic
1055292528 9:74797655-74797677 ATTTTATTTTTTAACAAAAATGG - Intronic
1055391596 9:75827755-75827777 CTTTTGTTCTTGTGCATATATGG - Intergenic
1055870720 9:80876060-80876082 CTATTGTACTTGGAGAAAAAGGG - Intergenic
1057672074 9:97101377-97101399 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1057822140 9:98340864-98340886 TTTTTGCTCAGGAACAAAAATGG + Intronic
1058981175 9:110172216-110172238 AATTTGTTCTTTAACTAAAATGG - Exonic
1059075611 9:111190671-111190693 TTTTTCTTCTTTTACAAAAATGG - Intergenic
1059086852 9:111312483-111312505 TTTATGTTCTTGAATAAAAGTGG + Intergenic
1059218862 9:112592953-112592975 CTTTTTTTCTTTCATAAAAATGG - Intronic
1059336233 9:113570083-113570105 CTTGTGCTCTTGGACAAGAATGG + Intronic
1060903645 9:127284595-127284617 CTTTTATTATCAAACAAAAAAGG - Intronic
1062702640 9:137915731-137915753 CTTTTGTTCTTGACTGTAAAGGG - Intronic
1185766488 X:2729841-2729863 CTTTTGTTCTTGAAGAATCTAGG - Intronic
1186370487 X:8941591-8941613 CTTTTATTTTTAAACAAAGAGGG + Intergenic
1187134189 X:16530701-16530723 CTTTGGTTCTTACAGAAAAAAGG + Intergenic
1187696441 X:21926469-21926491 CTTGGATTCTTGCACAAAAAAGG + Intergenic
1188037511 X:25335160-25335182 TCTTTGTTCTTAAAAAAAAAAGG + Intergenic
1188235183 X:27719876-27719898 CTTTTGTTCTTTTACAGACATGG - Intronic
1188366832 X:29326209-29326231 CATTTGTCTTTGAACAAAGAGGG + Intronic
1189173111 X:38928374-38928396 CTTTTGTCCATAAAAAAAAATGG - Intergenic
1189396213 X:40625069-40625091 CGTTAGTTCTTGGACAAAACAGG + Intergenic
1189933068 X:46035550-46035572 CTTTTGTCCTTGAAGAGTAATGG + Intergenic
1190592104 X:52014128-52014150 CTTTTATTCTTCTAAAAAAAAGG + Intergenic
1192400816 X:70833346-70833368 CCTTTGTTCTTTACCAGAAAGGG - Intronic
1193681819 X:84530224-84530246 CTATTGATCTTAACCAAAAACGG + Intergenic
1194901421 X:99516191-99516213 ATGTTGTTCTTGAACAATAATGG - Intergenic
1195695541 X:107664163-107664185 GTTTTGTTTTTTAAAAAAAAAGG - Intergenic
1195937022 X:110135228-110135250 CTTTTCTTCTAAAAAAAAAAAGG + Intronic
1199846689 X:151696684-151696706 ATTTTTTGCTTGAAGAAAAATGG - Intronic
1199973854 X:152879940-152879962 TCTTTGTTATTGAACAAAGACGG - Intergenic
1201755278 Y:17480457-17480479 CTTTTTTTCTTGGCCAATAATGG + Intergenic
1201846274 Y:18425528-18425550 CTTTTTTTCTTGGCCAATAATGG - Intergenic
1202072280 Y:21004641-21004663 ATTTTGGTAATGAACAAAAAAGG + Intergenic
1202270328 Y:23065998-23066020 CTTTTTTTTTTGGAAAAAAATGG + Intergenic
1202295699 Y:23354684-23354706 CTTTTTTTTTTGGAAAAAAATGG - Intergenic
1202423322 Y:24699743-24699765 CTTTTTTTTTTGGAAAAAAATGG + Intergenic
1202447467 Y:24970343-24970365 CTTTTTTTTTTGGAAAAAAATGG - Intergenic