ID: 1076055941

View in Genome Browser
Species Human (GRCh38)
Location 10:127372949-127372971
Sequence CCGGAGTCCCAGTACTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076055934_1076055941 3 Left 1076055934 10:127372923-127372945 CCCCTGCAGCATGGCTAGTCACC 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG No data
1076055935_1076055941 2 Left 1076055935 10:127372924-127372946 CCCTGCAGCATGGCTAGTCACCA 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG No data
1076055933_1076055941 4 Left 1076055933 10:127372922-127372944 CCCCCTGCAGCATGGCTAGTCAC 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG No data
1076055936_1076055941 1 Left 1076055936 10:127372925-127372947 CCTGCAGCATGGCTAGTCACCAG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG No data
1076055931_1076055941 12 Left 1076055931 10:127372914-127372936 CCTCAGGGCCCCCTGCAGCATGG 0: 1
1: 0
2: 2
3: 45
4: 459
Right 1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076055941 Original CRISPR CCGGAGTCCCAGTACTCAGA TGG Intronic
No off target data available for this crispr