ID: 1076056667

View in Genome Browser
Species Human (GRCh38)
Location 10:127380241-127380263
Sequence ACGTATAAGGTAGAGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076056664_1076056667 9 Left 1076056664 10:127380209-127380231 CCGCAAAGGTTTATTTTGTAGAA 0: 1
1: 0
2: 1
3: 35
4: 510
Right 1076056667 10:127380241-127380263 ACGTATAAGGTAGAGTTTGGTGG 0: 1
1: 0
2: 1
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076056667 Original CRISPR ACGTATAAGGTAGAGTTTGG TGG Intronic
904309375 1:29617920-29617942 ATTTATAAAGTACAGTTTGGCGG + Intergenic
907043020 1:51280405-51280427 TCTTATAAAGAAGAGTTTGGAGG + Intergenic
907875956 1:58488799-58488821 ACGTATACAGTGGACTTTGGGGG - Intronic
911982910 1:104587970-104587992 ACATATAAAGCAGAGTTTAGAGG + Intergenic
914662122 1:149800183-149800205 ATGCATAAGGTAAAGTATGGGGG + Intronic
923891643 1:238221672-238221694 AGGTATAAGGAAGAGATTAGTGG - Intergenic
1065869299 10:29942299-29942321 ACATTTAGGGTAGACTTTGGGGG + Intergenic
1066441644 10:35445156-35445178 CCTTAAAAGGTAGATTTTGGTGG + Intronic
1076056667 10:127380241-127380263 ACGTATAAGGTAGAGTTTGGTGG + Intronic
1076240621 10:128902834-128902856 ATGTATAAGAGAGAGTTTGGTGG - Intergenic
1080632665 11:34093371-34093393 GCCTATAAGGTAGAGGTGGGAGG - Intronic
1081566406 11:44263780-44263802 ACACATAAGCTAGAGCTTGGGGG - Exonic
1082597455 11:55101338-55101360 AGGTATTAGGAAGAGTATGGAGG + Intergenic
1087071174 11:94082372-94082394 ACATAAAAGGTACAGCTTGGAGG - Intronic
1090936087 11:131343882-131343904 ATGTACAAGGGAGAGTGTGGAGG + Intergenic
1093075338 12:14752504-14752526 AGTTATAAGGAACAGTTTGGAGG + Intergenic
1093696487 12:22166279-22166301 ATGTATCTGGTAGACTTTGGAGG - Intronic
1095415386 12:41971119-41971141 ACCTATAGGGCAGAGTTTGGGGG - Intergenic
1102712559 12:114940849-114940871 ATGTATAAGCTAGAGTTTCTTGG - Intergenic
1109416726 13:62050665-62050687 AGGTAGAAGGGAGAGTTGGGGGG - Intergenic
1110767671 13:79299424-79299446 AGGTATAGGGTAGAGGTAGGGGG + Intergenic
1111371093 13:87318726-87318748 ACGTATAAAGTAGAGTATAAAGG + Intergenic
1113098280 13:106689534-106689556 ACGTAAAAAGTAAAGTCTGGAGG + Intergenic
1114227801 14:20754730-20754752 AAGTATAAGGGAGTGTATGGTGG - Intergenic
1115258132 14:31424344-31424366 AATTAGAAGGTGGAGTTTGGAGG + Intronic
1122563472 14:102633928-102633950 ACATAGAAGGTAGATTTTTGAGG + Intronic
1125263446 15:37852910-37852932 AGGTATTAGGTATAGTTTTGTGG + Intergenic
1126737206 15:51742510-51742532 ATGTATCATGTTGAGTTTGGGGG + Intronic
1128393679 15:67201454-67201476 GCTTATAAGGTAGTGTCTGGAGG + Exonic
1134099112 16:11439192-11439214 AAATATAGGGTAGAGTTTGGAGG + Intronic
1136279480 16:29199553-29199575 ACTTTTAAGGTACAGTTTGGTGG + Intergenic
1138817597 16:60220809-60220831 ACCTGTAAGGTAAAGTTTTGAGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1145178050 17:20719064-20719086 ACGTATAAGGTGGTGTGTGCCGG + Intergenic
1153672743 18:7428077-7428099 ACTTCCAAGGTAGAGTTTCGTGG + Intergenic
1154264334 18:12866676-12866698 ACCTAAAAGGTACAGTTTAGTGG - Intronic
1156803791 18:41151476-41151498 ACATATAAGGTACAATTTGAGGG - Intergenic
1157060210 18:44279197-44279219 ACGTATAAGCTGTACTTTGGGGG + Intergenic
926753920 2:16221039-16221061 ACTTTTAAGGTAGAGTTTATCGG + Intergenic
931560029 2:63551053-63551075 ATTTATAAGGTAGACTTTAGTGG - Intronic
932080928 2:68714636-68714658 ACGGATAAAGTAGTGTTTAGAGG - Intronic
933454163 2:82500169-82500191 ACTTATGAGGTAGAGGTGGGAGG + Intergenic
935286553 2:101568907-101568929 ACATAAAAGGCAGAATTTGGGGG - Intergenic
938729887 2:134138903-134138925 ACTGATAAGGTACAGATTGGGGG + Intronic
939860682 2:147416631-147416653 ACTTAGAAGGTAGAATTTTGTGG - Intergenic
945363728 2:208925487-208925509 ACTTATAAGGTTTAGTTTGGTGG + Intergenic
948742272 2:240055768-240055790 ACATATCAGGGAGGGTTTGGGGG + Intergenic
1169052867 20:2595410-2595432 ACACACAAGCTAGAGTTTGGAGG - Intronic
1169298559 20:4421897-4421919 AAGTATAAGTTAAAGTGTGGGGG - Intergenic
1170054448 20:12184931-12184953 AATTAAAAGATAGAGTTTGGTGG - Intergenic
1170338762 20:15300078-15300100 ACGTATCAAGTTCAGTTTGGAGG - Intronic
1176976801 21:15330321-15330343 ATGTATAAGGTAGAGTTTTTTGG - Intergenic
1183567306 22:38624812-38624834 GGGAAAAAGGTAGAGTTTGGAGG - Intronic
1185328228 22:50238170-50238192 ACTTATGAGGGAGAGTTTGGGGG + Intronic
950313640 3:11980659-11980681 AAGTAGATGGCAGAGTTTGGGGG + Intergenic
951885421 3:27519458-27519480 ACATAATAGGTAGAGATTGGTGG - Intergenic
957499045 3:81029144-81029166 AGGAAAAAGGTAGAATTTGGGGG + Intergenic
959924441 3:111905641-111905663 ACTTTTAAGGTAGGGTGTGGTGG - Intronic
960021535 3:112960722-112960744 ACGTTTAACGCAGAGGTTGGGGG + Intronic
962878823 3:139556964-139556986 GCACATAAGGTAGAGTCTGGAGG + Intergenic
965781641 3:172292508-172292530 ACATAAAAGGTAGAGTTTAAAGG + Intronic
967886637 3:194337863-194337885 AAGTCTAAGGAAGGGTTTGGTGG + Intergenic
970980921 4:22096138-22096160 CATTAGAAGGTAGAGTTTGGAGG - Intergenic
976692362 4:87882603-87882625 ATGTAGAAAGTAGTGTTTGGTGG + Intergenic
978476157 4:109133411-109133433 ACTTATTAGGTAGAGTTTTGGGG - Intronic
980017047 4:127661724-127661746 AAGTATATGGAAGACTTTGGTGG - Intronic
986652196 5:9975194-9975216 GAGTATCAGGTAGAGTTTTGAGG + Intergenic
989495646 5:42108955-42108977 AGGTAACAGGAAGAGTTTGGAGG + Intergenic
991153926 5:63407814-63407836 CAGTATAAGGTAGAGTTTGGGGG - Intergenic
994751727 5:103746341-103746363 AAGTAAAAGGCAGAGTTTTGAGG + Intergenic
994760292 5:103843613-103843635 TCCTGTAAGGTAGAGTTTGGTGG + Intergenic
997094183 5:130892130-130892152 AAGAACAAGGTAGAGGTTGGAGG + Intergenic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
1013967470 6:115972130-115972152 ACCTATAAGGGAGAATGTGGTGG - Intronic
1017413467 6:154194575-154194597 AAGTGTAATCTAGAGTTTGGAGG - Intronic
1017800693 6:157893077-157893099 ACTTGTAACTTAGAGTTTGGAGG + Intronic
1026060123 7:67018430-67018452 ACGTAGGAGGTGGAGTTGGGAGG + Intronic
1026717993 7:72806757-72806779 ACGTAGGAGGTGGAGTTGGGAGG - Intronic
1028160734 7:87482120-87482142 AGGTATAAGGAAGAGTTTAGTGG - Intergenic
1036938137 8:13025182-13025204 AAATAGAAGGGAGAGTTTGGGGG + Exonic
1044833531 8:96274017-96274039 ACTTTTAAGGAAGAATTTGGAGG - Intronic
1052218168 9:25991136-25991158 GGGTAACAGGTAGAGTTTGGAGG - Intergenic
1185564552 X:1085419-1085441 AAGGAGTAGGTAGAGTTTGGGGG + Intergenic
1188171842 X:26937238-26937260 ATATATCAGGTTGAGTTTGGAGG + Intergenic
1189146158 X:38657207-38657229 AAGTATAAGGTAGAGCTGTGTGG + Intronic
1197090960 X:122536731-122536753 ACAGCTAAGGTAGAGCTTGGGGG + Intergenic
1197177761 X:123503234-123503256 CCGGATAAGGGAGAGTTTGTTGG + Intergenic