ID: 1076058219

View in Genome Browser
Species Human (GRCh38)
Location 10:127392693-127392715
Sequence CCAGGGGCTCAGTCTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076058219_1076058236 28 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG No data
1076058219_1076058238 29 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058238 10:127392745-127392767 CCACCCCCAGCGCCGGGTCGGGG No data
1076058219_1076058239 30 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058219_1076058234 27 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data
1076058219_1076058230 22 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058230 10:127392738-127392760 CACCTCCCCACCCCCAGCGCCGG No data
1076058219_1076058231 23 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058231 10:127392739-127392761 ACCTCCCCACCCCCAGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076058219 Original CRISPR CCAGGGGCTCAGTCTGAGTC AGG (reversed) Intronic
900717889 1:4156848-4156870 CCAAGGGCTCTGTCTGGGGCTGG + Intergenic
901887005 1:12230274-12230296 CGAGGGGCTCAGACCGAGGCCGG - Intronic
902921365 1:19667786-19667808 CCAGGGGGTCAATAGGAGTCAGG - Intronic
903196154 1:21689804-21689826 CCTGGGGCTCAGCCAGAGTTGGG + Intronic
904176003 1:28629446-28629468 CCAGATGCTCAGGCTGAGGCAGG - Intronic
905828049 1:41041968-41041990 GCAGTGGCTCAGTATGAGGCAGG - Intronic
906282282 1:44562629-44562651 CCAGGGGCTAAGTCGGGGTTGGG + Intronic
906666553 1:47626198-47626220 CAAGGGGCTCTGTCTCAGTAGGG + Intergenic
909883849 1:80915189-80915211 GCAGGTGCTCAGTGTGAGTCAGG - Intergenic
912458341 1:109814644-109814666 CCAGAGGCTCAGTGGGATTCAGG - Intergenic
915225537 1:154408461-154408483 CCAGTGGCCCGGTCAGAGTCTGG - Intronic
917021631 1:170594559-170594581 CCAGGGGCTCTGGCAGAGTTTGG - Intergenic
920164989 1:204029397-204029419 GGAGGGTCTCAGGCTGAGTCGGG + Intergenic
920493499 1:206437630-206437652 GCAGGGGCTCAGTCCCAGCCTGG + Intronic
920664908 1:207956140-207956162 CCAGGGCCTCAGGCTGAGTGGGG + Intergenic
922313108 1:224414912-224414934 CCAGCTGCTCAGGCTGAGACGGG + Intronic
922537574 1:226392513-226392535 CAAGGAGCTCAGTCTGAGAAGGG - Intronic
923665176 1:235993009-235993031 CCAGGGGCCCTGTGTGACTCTGG - Intronic
1063618877 10:7626562-7626584 CCAGGGTCCCGGTCTGGGTCCGG - Intronic
1064607873 10:17062997-17063019 CCAGCAGCTCACTCTGACTCTGG + Intronic
1065732368 10:28721331-28721353 CCAGGGGAACAGTCTGAGGTAGG + Intergenic
1065857452 10:29841887-29841909 CCAAAGGCTCTGTCTGAGCCCGG - Intergenic
1065987709 10:30972614-30972636 GAAGGGGCCCAGGCTGAGTCTGG - Intronic
1067567168 10:47347722-47347744 GCAGAGGCTGAGTCTGAGGCTGG - Intergenic
1073584948 10:104700790-104700812 GCAGGGGCTCAGCCTTAGCCTGG + Intronic
1074943069 10:118253953-118253975 CCAGGGTCTCACTCTCAGCCTGG - Intergenic
1075671046 10:124264368-124264390 CCACGGGCTCAATCTGGATCAGG + Intergenic
1075797677 10:125132538-125132560 CCAGGTGCTGAGTCAGAGGCTGG - Intronic
1075885406 10:125895960-125895982 CCAGGGGCTCCCTCCGAGCCCGG - Intronic
1076058219 10:127392693-127392715 CCAGGGGCTCAGTCTGAGTCAGG - Intronic
1077258954 11:1605167-1605189 CCAGGGGCTCAGGGTGTGGCTGG - Intergenic
1077494617 11:2880846-2880868 CCAGGGGATCAGGGTGAGGCAGG - Intergenic
1077615302 11:3669825-3669847 CCAGGGTCACATTCAGAGTCTGG + Exonic
1080583957 11:33665530-33665552 CCTGGGGCTCAGTCAGAGCAGGG - Intronic
1082782604 11:57299527-57299549 CCAGGGGCTCACTCTGACACTGG - Intergenic
1083484529 11:62975121-62975143 CCAGGGGCTCAGGTTGACTTAGG - Intronic
1083870941 11:65488180-65488202 CCACAGGCTCAGTCTCAGCCTGG - Intergenic
1084688777 11:70712689-70712711 CTGGCGGCTCAGTCTGAGTGAGG - Intronic
1084974553 11:72789690-72789712 CTAGGGGCTCTGTCTGAGAATGG + Intronic
1087525807 11:99311041-99311063 CCAGCTGCTCAGGCTGAGGCAGG - Intronic
1088355628 11:108941211-108941233 CCAGGAGCTGAGTCTGGGTGGGG - Intergenic
1089662476 11:119994392-119994414 CCATGGGCCCATTCTGATTCTGG - Intergenic
1093356324 12:18172840-18172862 GCAGGTGCTCAGAATGAGTCAGG - Intronic
1095426009 12:42075383-42075405 ACAGGGGTTCAGTCAGCGTCTGG - Intergenic
1096630732 12:52925333-52925355 CCAGGGGCTCAGGCTGAGTCAGG + Intronic
1097071015 12:56354916-56354938 CTGGGGTCTCAGTCAGAGTCAGG + Intronic
1097178249 12:57156084-57156106 ACAGGTGCTCAATCTGAGACGGG - Exonic
1097806246 12:63967915-63967937 CCTGGGGCTCAGCCTAAATCTGG - Intronic
1101350904 12:103929525-103929547 CTGGGGGGTCGGTCTGAGTCTGG - Intergenic
1101601708 12:106215416-106215438 CCAGGGGCTAAGGCTGGGGCTGG + Intergenic
1103515494 12:121505427-121505449 CCAGGGGCTCAAGATGAGCCTGG + Intronic
1104017216 12:124969163-124969185 CCAGGGGGTCTTTCAGAGTCAGG + Intronic
1104618021 12:130286394-130286416 CCAGGTGCACAGTCTCAGTGTGG + Intergenic
1104854675 12:131896100-131896122 CTAGGGGCCCTGCCTGAGTCCGG + Intronic
1110386948 13:74923478-74923500 CCAGGGGCTGAGTTTGAAACTGG + Intergenic
1111075112 13:83224592-83224614 CCAGGTGCTCAGTCTGGGAATGG + Intergenic
1113314203 13:109161377-109161399 TCTGGGCCTCAGTCTGAATCTGG + Intronic
1120347925 14:83313980-83314002 CCAGCTACTCAGTCTGAGGCAGG - Intergenic
1121022113 14:90586590-90586612 GGAGGGGCTCAGTCTCAGTCTGG + Intronic
1121273212 14:92651540-92651562 GCAGGGGGTCAGTCTGTGCCAGG - Intronic
1121302760 14:92885157-92885179 CCATGGGGTCAGGCTGAGTCTGG + Intergenic
1121708190 14:96016951-96016973 CCAGGCACTCAGTCTGGGCCAGG + Intergenic
1121777525 14:96600192-96600214 CCTGAGGCTGAGGCTGAGTCTGG + Intergenic
1121908661 14:97769589-97769611 AATGTGGCTCAGTCTGAGTCCGG + Intergenic
1122047289 14:99033248-99033270 CCAGGCCCAAAGTCTGAGTCTGG + Intergenic
1122051769 14:99065671-99065693 CCAGGAGATCAGGCTGAGACTGG + Intergenic
1122869909 14:104633772-104633794 GCAGGGCCTCAGGCTAAGTCAGG - Intergenic
1202872645 14_GL000225v1_random:177957-177979 CCAGGGGCTCCCTCCGAGCCCGG + Intergenic
1124710129 15:32002777-32002799 CCAGAGGCTCAGTCAAACTCAGG - Intergenic
1128154567 15:65384633-65384655 CCAGAGGCCCTGACTGAGTCTGG - Intronic
1128355759 15:66925324-66925346 CCAGGGCCTCCATCAGAGTCTGG + Intergenic
1129371501 15:75098756-75098778 CTAGGGACTCAGCCTGAATCTGG - Intronic
1129691985 15:77718979-77719001 ACAAGGCCTCAGTCTGTGTCTGG + Intronic
1130430655 15:83843685-83843707 CCTGGGACTCACCCTGAGTCAGG + Intronic
1130650038 15:85757201-85757223 CCCAGGGGTCAGACTGAGTCTGG - Intergenic
1132993606 16:2811069-2811091 TCAGGGGCTCAGTGTAACTCAGG + Intergenic
1133206167 16:4235083-4235105 GCAGGGGCCCAGCCTGAGTAGGG + Intronic
1133221172 16:4319807-4319829 CCAGGGGCTAAGCCGGAGCCAGG - Intronic
1133897870 16:9946434-9946456 CCAGGGGCCCAGTCACAGTTGGG - Intronic
1134236029 16:12467138-12467160 CCAGTGGCTCAGACTCAGTAAGG + Intronic
1134337753 16:13317035-13317057 CTAGGGACTCAGTCTGGGACAGG - Intergenic
1136008632 16:27348038-27348060 CCAGGGGCCCAGGCTGGGCCTGG + Intronic
1136098776 16:27978009-27978031 CCAGGGGCTCTGGCTGAGCGAGG + Intronic
1136413540 16:30090825-30090847 CCCGGGGGTCAGCCTGAGCCTGG - Exonic
1137624358 16:49898321-49898343 ACAGGGTCTCACTCTGAGGCAGG + Intergenic
1138202466 16:55100541-55100563 CCATGGGGTCAGGCTGAGGCTGG - Intergenic
1139322794 16:66129074-66129096 CCAGGGGATCAGGCTGAGGTTGG - Intergenic
1139442555 16:66975851-66975873 CCAGCAGCTCAGTCTGACTGAGG - Intergenic
1139474166 16:67194346-67194368 CCATGGGCTCAATCTGAGCTGGG - Intronic
1139652328 16:68368620-68368642 CCCGGGGCAGAGGCTGAGTCTGG + Intronic
1139664897 16:68448490-68448512 CCAGGTGCTGAGTCTGAGGGAGG - Exonic
1140532528 16:75679195-75679217 CCAGGGGTTCAGTCTAGGTCGGG - Intronic
1140704427 16:77613467-77613489 CCAGGGGCTCTGTCTTATTGGGG - Intergenic
1141675566 16:85515578-85515600 CCAGGGGCCCAGACTGGGCCAGG + Intergenic
1142031992 16:87843133-87843155 CCATCAGCTCAGGCTGAGTCCGG - Intronic
1142613560 17:1122537-1122559 CCAGTGTTTCAGTCCGAGTCTGG - Intronic
1143411626 17:6712915-6712937 CCAGGGGCTGAGCCTAAGGCTGG + Intronic
1144799330 17:17914238-17914260 CCTGGGGCTCATTCTGTGTCTGG + Intronic
1144829983 17:18125921-18125943 CCAGGGGCTCAGTGCCAGTGTGG + Intronic
1145000809 17:19303363-19303385 CCAGGACCCCAGGCTGAGTCTGG + Intronic
1146548642 17:33761439-33761461 CCTGGTGCTCAGTCAGAGCCTGG - Intronic
1146647303 17:34583695-34583717 CCTGGGTTTCAGTCTGACTCTGG + Intronic
1147703778 17:42412169-42412191 CAAAGGGCTCAGTCTCAGGCAGG + Intronic
1147967813 17:44202991-44203013 CCAGGGCCTCACCCAGAGTCAGG - Intergenic
1149045065 17:52235760-52235782 CCAAGAGCTGAGTCTGACTCAGG - Intergenic
1149587527 17:57802540-57802562 TCATGGGATCAGGCTGAGTCTGG + Intergenic
1150338929 17:64350110-64350132 CCAGTAGCTCATTATGAGTCAGG + Intronic
1152740063 17:82014877-82014899 CCAGGCCCTCAGGCTGTGTCAGG + Intronic
1153403604 18:4708987-4709009 CCAGGGGCTCAGTGAGAGAGAGG + Intergenic
1156298763 18:35817631-35817653 CCAGGGACTCAGCCTGAGCAGGG - Intergenic
1158596544 18:58821620-58821642 TCAGGGGCTGAGTCTGACACTGG + Intergenic
1158878623 18:61755219-61755241 CCTGGGCCTCTGTCTCAGTCTGG - Intergenic
1160439700 18:78879794-78879816 CCAGACACTCAGGCTGAGTCAGG + Intergenic
1160657406 19:280659-280681 CCAGGGCCTGAGTCTGGGTGGGG - Intergenic
1161722132 19:5908992-5909014 CCAGGCGCTCAGCCTCAGCCAGG - Exonic
1162009657 19:7804572-7804594 CCAGGGGCTCAAGCTCAGCCTGG + Intergenic
1163274633 19:16275737-16275759 CCAGGGGCAATGTGTGAGTCTGG - Intergenic
1164604174 19:29584327-29584349 CCACGGGGTTAGGCTGAGTCTGG - Intergenic
1165920227 19:39292840-39292862 GGAGGTGCTCACTCTGAGTCAGG - Intergenic
1166780850 19:45342007-45342029 CCCGGGGCTCTGTGTGAGTGTGG + Intronic
1166936247 19:46334964-46334986 CCAGGGGCTCATTCAGGTTCAGG - Exonic
924960748 2:32215-32237 CCAGGGGCTGAGTGGGAGGCGGG + Intergenic
925029269 2:636732-636754 CCAGGGGCTCAGGCTCGCTCAGG + Intergenic
926329066 2:11810066-11810088 CTAGGGGCTCCCTCTGAGTTTGG - Intronic
930055504 2:47249016-47249038 CCTGGGGCTGAGTGTGAGTCTGG - Intergenic
931127265 2:59292069-59292091 CCAGGGATTCAGTCTGATCCTGG + Intergenic
931369801 2:61651433-61651455 CCAGCTGCTCAGGCTGAGGCAGG + Intergenic
932485341 2:72081107-72081129 CCTGGGGCTCAGTCAGAGAAGGG + Intergenic
934117687 2:88812132-88812154 TCAGAGGCTCAGTGTGAGCCAGG - Intergenic
936161343 2:110086198-110086220 TCAGGGGCTCAGTGTGAGCCAGG - Intronic
936183320 2:110285156-110285178 TCAGGGGCTCAGTGTGAGCCAGG + Intergenic
936667268 2:114610821-114610843 CCAGCAGCTCAGTCTGCATCTGG + Intronic
938112849 2:128580807-128580829 GCAGGGGCTGAGGCTGAGGCAGG - Intergenic
942043821 2:172087693-172087715 CCAGGGGCTCAGTCCGACCGTGG - Intronic
944091121 2:195912881-195912903 TCAGGCTCTCAGCCTGAGTCAGG + Intronic
945836754 2:214842987-214843009 CCAGCTGCTCAGACTGAGGCAGG + Intergenic
946713278 2:222527725-222527747 CCTGGGCCTAAGCCTGAGTCAGG - Intronic
947526152 2:230877926-230877948 CCTGTGGCTCAGGCTGAGGCTGG + Intronic
948675856 2:239596204-239596226 TCAGGGGCTCAGCCTCACTCGGG - Intergenic
1169400077 20:5272192-5272214 CCATGGGATCAGGCTGAGGCTGG + Intergenic
1169408807 20:5349368-5349390 GCAGGTGTTCAGTCTGAGCCTGG + Intergenic
1173336356 20:42115234-42115256 CCAGGGGCTCTGTTTCAATCAGG + Exonic
1174454847 20:50641805-50641827 CCAGCGGCTCTGTCTCAGCCAGG - Intronic
1174563474 20:51447635-51447657 ACAGGGCCTCAGGCGGAGTCGGG - Intronic
1174635463 20:51995823-51995845 CCAGGGGCAGAGTCTGGGGCTGG + Intergenic
1175284731 20:57830445-57830467 CAAGGGCCTCTGTCTTAGTCAGG + Intergenic
1176021020 20:62962524-62962546 CCAGGGGCTCAGCCTGCACCAGG + Intronic
1176076053 20:63248694-63248716 GCAGGGGCTCAGTCTGTGCATGG - Intronic
1176725194 21:10426007-10426029 CCAGAGGCTTGGTCAGAGTCAGG + Intergenic
1179285094 21:39970386-39970408 CCAGGGGTTCAGCCTAGGTCTGG - Intergenic
1179297814 21:40079074-40079096 CCAGGAGCTCAGTCCAAGTCTGG + Intronic
1179344768 21:40546348-40546370 CCAGGGCCTCAGGCAGACTCTGG + Intronic
1180839060 22:18950290-18950312 CCAGTGGCACAGTCAGAGCCGGG + Intergenic
1181290001 22:21784420-21784442 ACAGTGGCTCAGGCTGAGACGGG + Intronic
1182047513 22:27287321-27287343 CCAGAGGCTCTGTCTGAAGCTGG + Intergenic
1183418756 22:37697785-37697807 CCTGGGGCTCTGTGTGAGTGGGG + Intronic
1184340506 22:43883333-43883355 CCAGGAGCTGGGTCTGCGTCGGG + Intronic
1184510539 22:44930697-44930719 CCAGGAGCTGAATGTGAGTCAGG + Intronic
1184536535 22:45091458-45091480 CCAGGCACAAAGTCTGAGTCGGG + Intergenic
1184834006 22:47009924-47009946 ACACTGGCTGAGTCTGAGTCAGG + Intronic
1184861252 22:47174394-47174416 CCAGGGGCTCTGGCTGAGGCCGG - Exonic
1185223123 22:49639207-49639229 GCAGGGACTGAGGCTGAGTCCGG + Intronic
1185325957 22:50225984-50226006 CCTGGGGCTGAGTATGAGGCTGG - Intronic
950004857 3:9685120-9685142 CCAGTGACACAGTCTGTGTCTGG + Intronic
952062518 3:29527486-29527508 CCAGGGGCTCAGTATGTATGAGG + Intronic
953335968 3:42094214-42094236 CCAGCTGCTCAGCCTGAGCCTGG - Intronic
953931901 3:47009762-47009784 CCAGGGTCGCCGTCTGAGTCTGG + Intergenic
954419866 3:50413078-50413100 CCAGGGGATCAGTGTGAATTAGG + Intronic
954451103 3:50572151-50572173 CCAGGGGCTCAGCCTAAGGATGG + Exonic
954650869 3:52162128-52162150 CCCTGGGCTCAGTCAGAGTAGGG - Intergenic
954743402 3:52772558-52772580 GCAGGGGCTCACTTAGAGTCTGG + Intergenic
954903278 3:54038639-54038661 TAAGGGCCTCAGCCTGAGTCTGG + Intergenic
955732763 3:62004684-62004706 CCAGGGGTTCGGTCTAGGTCCGG - Intronic
959943094 3:112099990-112100012 ACAGGAGTTCAGACTGAGTCTGG + Intronic
962704210 3:138027746-138027768 ACAGGGGCTCTGTCTGTGTCAGG + Intronic
966917929 3:184594914-184594936 CCAAGGGCTCAGGGTGAGTGGGG + Intronic
968647583 4:1748263-1748285 CCCGGGGCTCAGGCTGGGTAGGG - Intergenic
971328867 4:25665860-25665882 CCAGGGGCTCACAGTGGGTCGGG + Intronic
971706025 4:30044734-30044756 CCAGGGGACCACTCTGAGTTAGG + Intergenic
973284845 4:48403603-48403625 CCAGGAGTTCGGTCTGTGTCAGG + Intronic
975858841 4:78654666-78654688 TCAGGGGCTGAGGCTGAGGCAGG - Intergenic
976072361 4:81256392-81256414 GCAGGGCCACAGTGTGAGTCGGG - Intergenic
976086341 4:81410684-81410706 CCATGGGATCAGGCTGAGTCTGG + Intergenic
978406068 4:108380042-108380064 TGAGGGGATCAGTCTGGGTCAGG + Intergenic
981694911 4:147550287-147550309 CCTGGAGATCAGGCTGAGTCTGG + Intergenic
984265216 4:177490173-177490195 CCAGGCCCTCACTCTGAGTGGGG + Intergenic
984740658 4:183158366-183158388 CCAGAGGCTGAGTCTGAGACCGG + Intronic
986195693 5:5534945-5534967 CCAGGGGCTCAGTCCGTGGATGG - Intergenic
987160211 5:15133769-15133791 CCAGGGGCTAGGTCTAAGTGAGG + Intergenic
993901581 5:93587695-93587717 CCAGGGGCTCAGGCAGTGGCTGG + Intronic
994146625 5:96402474-96402496 CCAGGCACTGAGTCTGAGTGAGG - Intronic
994194717 5:96909632-96909654 ACAAGGGCTCAGTCTGGGACAGG + Exonic
996321028 5:122217083-122217105 CCAGGGGCTCAGTTTGGGGGAGG + Intergenic
997234800 5:132266572-132266594 CCCTGGGCTCACTCTGAGCCAGG - Intronic
997354156 5:133251738-133251760 CCAGGGGTTCGGTCTAGGTCTGG - Intronic
998055302 5:139071047-139071069 CCAGGGGCTCAATCGGACACAGG - Intronic
998573957 5:143292658-143292680 CCAGGGACCCAGTCTTAGTGGGG - Intronic
998638110 5:143979695-143979717 CCAAGGCCTATGTCTGAGTCAGG - Intergenic
998856956 5:146403092-146403114 CCTGGGGCTCAGGCTGCCTCTGG + Intergenic
999637260 5:153635679-153635701 CCAGGGGCTCAGTCTGGAGCTGG - Intronic
1002911030 6:1491117-1491139 CCCAGGGCTCAGGCTGAGTAAGG + Intergenic
1005854740 6:29852433-29852455 CCTGGTGTTCTGTCTGAGTCAGG + Intergenic
1006364667 6:33608340-33608362 CCGGGGACTCAGGCTGAGTGGGG + Intergenic
1007992408 6:46270466-46270488 CGAGAAGCTCAGTCTGACTCTGG - Intronic
1008589901 6:52983650-52983672 CCAAGGGCCCAGACTGTGTCAGG - Intronic
1011124991 6:83997521-83997543 TCAGGAGATCAGTCTGACTCAGG + Intergenic
1011920979 6:92577195-92577217 CCAGGGGCTCTGTCTCAGGCAGG - Intergenic
1014268702 6:119312129-119312151 CAAGGGGCTGTGTCTGATTCAGG + Intronic
1014980747 6:127943433-127943455 CCAGGGGCTGGATCTGAGTTAGG + Intergenic
1015594379 6:134852272-134852294 CCTGGACCTCAGTCTGAGTGTGG - Intergenic
1017344233 6:153361490-153361512 CCAGGGCCTCTGTCTGTGTGGGG + Intergenic
1019032338 6:169024223-169024245 CCATGGGCTGAGTCTGGGCCTGG + Intergenic
1019306622 7:338525-338547 CCACGGGATTAGTCTGAGTCTGG - Intergenic
1024099526 7:46015908-46015930 CTAGGGGCTCAGGCTCAGTGAGG - Intergenic
1026858678 7:73770760-73770782 GCACAGGCTCAGCCTGAGTCCGG + Intergenic
1027829744 7:83162659-83162681 CCAGGGGAGCAGTCAGAGCCGGG + Exonic
1028193202 7:87876030-87876052 CGAGGGGCTTTGGCTGAGTCCGG - Intronic
1028903990 7:96132957-96132979 CCACAAGCTCAGTTTGAGTCAGG - Intronic
1030690891 7:112531911-112531933 CTATAGGCTCAGTCTCAGTCTGG - Intergenic
1031264317 7:119565030-119565052 CCTGGGGCAAAGTCTGAGTGGGG + Intergenic
1032512923 7:132486455-132486477 CCAGGGGAACAGTCTGAGTTGGG - Intronic
1032643851 7:133799322-133799344 CCAGGAGCTGAGTCTGACTGAGG + Intronic
1034241984 7:149617733-149617755 CCTGGAGCTCAGTCTGAGCAGGG + Intergenic
1034438249 7:151073965-151073987 CCTGGGGCTCAGTGAGTGTCGGG - Intronic
1034612557 7:152385077-152385099 CCAGAGGCTTGGTCAGAGTCAGG - Intronic
1035563523 8:626730-626752 CCAGGGGCTCAGGATGAGGATGG - Intronic
1037675964 8:21050945-21050967 CCTGGGACTCAGACTGAGGCCGG - Intergenic
1037878816 8:22562686-22562708 ACAGAGGCTCAGACTGAGTGAGG - Intronic
1043132845 8:76483093-76483115 CCAGGAGAGCAGTCTGAGTTTGG - Intergenic
1045062961 8:98424522-98424544 CCAGGGGCCCAGGCAGAGCCTGG + Intronic
1048263766 8:132967385-132967407 CCAGGGGCACAGGCTGACTTGGG + Intronic
1048363293 8:133716072-133716094 CCAGGGGCTTTGACTCAGTCAGG + Intergenic
1048566623 8:135606449-135606471 CAAGGGGTGAAGTCTGAGTCAGG + Intronic
1049595150 8:143480028-143480050 CGAGGGGCCCAGGCTGAGGCAGG - Intronic
1049598314 8:143494702-143494724 CCAGGGTCTCAGGGTGAGTGTGG - Intronic
1049666361 8:143845152-143845174 CCTGGGGCACAGCCTGAGTGAGG - Intergenic
1049688300 8:143948031-143948053 GCAGGGGCTCCATCTGGGTCTGG + Intronic
1049781399 8:144430646-144430668 CCAGGGGCTCTGCCTCAGCCTGG + Intronic
1050482165 9:6098448-6098470 TCAGGGGACCAGTCTGAGACAGG - Intergenic
1052971471 9:34379788-34379810 CCAGGGGCTTGGTCTAAATCGGG - Intronic
1054718622 9:68581832-68581854 CCATGGGATCAGGCTGAGACTGG + Intergenic
1057180079 9:93025050-93025072 TCAGGGCCTCAGTCAGTGTCCGG + Intronic
1058696659 9:107564660-107564682 CCAGGGCCTCAGCCTCAGGCAGG - Intergenic
1058717933 9:107739096-107739118 TCTGGGGCTCACTCTGTGTCAGG - Intergenic
1059321915 9:113476634-113476656 CCAGGGGCAAAGGCTGACTCGGG - Intronic
1059485223 9:114621822-114621844 TGAGGGGCTCAAGCTGAGTCTGG + Intronic
1061187998 9:129066229-129066251 TCAAGGGCTCAGGCTGGGTCCGG - Intronic
1062184174 9:135207883-135207905 GCAGTGGCTTAGTCTGAGTCTGG - Intergenic
1203731812 Un_GL000216v2:98585-98607 CCAGGGGCTCCCTCCGAGCCCGG - Intergenic
1186459987 X:9740217-9740239 CCTGAGGCTCAGACGGAGTCTGG + Intronic
1190457918 X:50643483-50643505 CAAGGGGCTCAGGCACAGTCAGG + Intronic
1192201120 X:69067368-69067390 CCAGAGGGTCAGTCGGAGTGAGG - Intergenic
1192534769 X:71917864-71917886 CTGGGGGCTTATTCTGAGTCAGG - Intergenic
1192555938 X:72089386-72089408 CCAGGGACTCATTCTGAGCTTGG - Intergenic
1193533619 X:82686470-82686492 CCAGGGACTCAGTCTCATTGAGG + Intergenic
1193882337 X:86938215-86938237 CCAGGGGCTGAGAATGAGACAGG - Intergenic
1195002144 X:100652127-100652149 TCAGTGGTTAAGTCTGAGTCAGG + Intronic
1195255002 X:103081886-103081908 CCAGGGCCTCATGCTGAGACAGG - Intronic
1200788876 Y:7282305-7282327 CCAGGAGCTCAGTATCTGTCTGG + Intergenic