ID: 1076058223

View in Genome Browser
Species Human (GRCh38)
Location 10:127392709-127392731
Sequence ATGGCCTTTCGCTCTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076058223_1076058239 14 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058223_1076058231 7 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058231 10:127392739-127392761 ACCTCCCCACCCCCAGCGCCGGG No data
1076058223_1076058238 13 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058238 10:127392745-127392767 CCACCCCCAGCGCCGGGTCGGGG No data
1076058223_1076058230 6 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058230 10:127392738-127392760 CACCTCCCCACCCCCAGCGCCGG No data
1076058223_1076058236 12 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG No data
1076058223_1076058234 11 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076058223 Original CRISPR ATGGCCTTTCGCTCTCCCAG GGG (reversed) Intronic
900497829 1:2984298-2984320 ATGGCCTCTGGCTGTCCGAGGGG - Intergenic
901167014 1:7228576-7228598 AAGGGCTGTGGCTCTCCCAGGGG + Intronic
903388804 1:22948896-22948918 ATTGCCTTTCCCTCTTCCATCGG + Intergenic
906539816 1:46576720-46576742 GTGGCCTTGCATTCTCCCAGAGG - Intronic
907419745 1:54339042-54339064 ATGGGCCTTCTCTCTCCCACAGG + Intronic
909391377 1:75125517-75125539 AGGCCCTTTCTCTCTCCCGGAGG - Intergenic
910851485 1:91653671-91653693 ATGGCCTTACTCTCTTTCAGAGG - Intergenic
913995639 1:143650321-143650343 ATGGCCTTTGGGTTACCCAGGGG - Intergenic
916793629 1:168146057-168146079 AGGCCCTTTCGCTCTCTGAGAGG - Intergenic
917972384 1:180217143-180217165 ATGGCCTGGCACCCTCCCAGTGG - Intergenic
918372113 1:183870877-183870899 AGGGCCTTTCCCTCTCCATGTGG - Intronic
919838728 1:201594185-201594207 ATGGCCTTTTGATCTACCAATGG - Intergenic
920096328 1:203488662-203488684 ATGGACTGTCCCTCCCCCAGAGG + Exonic
1066397604 10:35041380-35041402 TTGGCCTTTCTTTCCCCCAGGGG - Intronic
1069827633 10:71263767-71263789 ATGACCATCCCCTCTCCCAGGGG + Intronic
1070437675 10:76409837-76409859 ATGAACTTCTGCTCTCCCAGAGG + Intronic
1073150205 10:101306175-101306197 TTAGCCTTTCTCTGTCCCAGGGG + Intergenic
1073857992 10:107699524-107699546 ATTGCATGTAGCTCTCCCAGGGG + Intergenic
1074391816 10:113064246-113064268 CTGGCCCCTCCCTCTCCCAGAGG - Intronic
1076058223 10:127392709-127392731 ATGGCCTTTCGCTCTCCCAGGGG - Intronic
1076290198 10:129340164-129340186 ATGTCCTTTTGCTCTCCTTGCGG + Intergenic
1080760825 11:35247358-35247380 ATGGCCTTTCACTGCCTCAGTGG + Intergenic
1080852316 11:36080447-36080469 ATTGCCTCTCTCTCTGCCAGAGG - Intronic
1082926256 11:58550485-58550507 TTGGCCTTTTCCTCTTCCAGGGG - Intronic
1084945463 11:72636000-72636022 ATGCCCTTCCTGTCTCCCAGTGG + Intronic
1088068910 11:105756973-105756995 ATCTCCTTTTGCTCTCCCACTGG - Intronic
1088422758 11:109667373-109667395 GGGTCCTTTCCCTCTCCCAGTGG - Intergenic
1089140677 11:116281506-116281528 GTGGCCTTTCTCTGTCCCACAGG - Intergenic
1089195821 11:116693480-116693502 TGGGCCTTTCGCTCTCTCACTGG - Intergenic
1092771164 12:11898137-11898159 ATAGCACTTAGCTCTCCCAGAGG - Intergenic
1095837838 12:46657600-46657622 ATGGCATTGAGCTCTCCCAAGGG - Intergenic
1096657937 12:53103415-53103437 ATAACCTATCGCACTCCCAGAGG + Intergenic
1103931723 12:124454138-124454160 CTGGCCGGCCGCTCTCCCAGGGG + Intronic
1104390763 12:128389032-128389054 CTGGTCTTTGTCTCTCCCAGGGG - Intronic
1106485151 13:30165974-30165996 CTGGCCCTCTGCTCTCCCAGAGG - Intergenic
1107206499 13:37796467-37796489 ATGGCCATTCAGTTTCCCAGTGG + Intronic
1108294084 13:48995200-48995222 AAGGCCTTTCACTCTTACAGTGG - Intronic
1113308892 13:109110037-109110059 ATGGCCTTTGGCACTCCCTGGGG - Intronic
1113825180 13:113247155-113247177 ATGGCCTGGCGCCCTCCCTGTGG - Intronic
1118995347 14:70830568-70830590 TTCGCCTTTTTCTCTCCCAGTGG - Intergenic
1119979236 14:79060881-79060903 ATGGCTGTTCGCTCTCTCAGAGG + Intronic
1127985308 15:64065577-64065599 AAGGTCTTTCCCTCTCCTAGGGG - Intronic
1128664505 15:69528343-69528365 ATGGCCCTTCTCTCACCGAGCGG - Intergenic
1133010113 16:2905864-2905886 TTGGCCCTTCGCTCGCCCATTGG - Intergenic
1137888330 16:52130573-52130595 ATCTCCTTTCTCTCTCCCAAAGG + Intergenic
1139258896 16:65573158-65573180 ATGGCCTTTCATTTTCACAGTGG + Intergenic
1140335500 16:74101071-74101093 GTGGCTTTTCTCCCTCCCAGGGG + Intergenic
1142093964 16:88229879-88229901 AGGGCCGGTGGCTCTCCCAGGGG + Intergenic
1143724886 17:8837978-8838000 ATGGCCCTTTGCTCTCCCCCTGG - Intronic
1145290981 17:21545702-21545724 ATGGCTTGGTGCTCTCCCAGTGG + Intronic
1146793422 17:35765541-35765563 GTGGCCTTGTGCTCTCACAGTGG - Intronic
1148245006 17:46024806-46024828 ATAGGCCTTGGCTCTCCCAGCGG - Exonic
1160923484 19:1531749-1531771 ATGGGCTGCTGCTCTCCCAGGGG - Exonic
1160987480 19:1845869-1845891 ATGCCCTCTCCTTCTCCCAGAGG + Intronic
1162361061 19:10220828-10220850 GTGGCCTTTCTCTAGCCCAGTGG + Intronic
1162918399 19:13886271-13886293 GTGGCCTTTCTCTTTCCAAGGGG - Intronic
1163050757 19:14681942-14681964 ATGGCCTCTGGCTCTCTCATGGG - Intronic
1165094074 19:33401122-33401144 CTGGTGTTTCTCTCTCCCAGCGG - Intronic
1166193329 19:41190439-41190461 ATGTCTGTTAGCTCTCCCAGGGG + Intergenic
1167628456 19:50607762-50607784 TTCGCATTTCTCTCTCCCAGGGG - Intergenic
925912108 2:8580871-8580893 CTGGCCTTTCGCTCCAGCAGTGG - Intergenic
926340073 2:11898105-11898127 ATGACCTTTCCCCCTGCCAGTGG - Intergenic
927216046 2:20668275-20668297 TTGACCTCTGGCTCTCCCAGGGG - Intronic
928379754 2:30807545-30807567 ATGTCCTCTCTCTCTCCAAGAGG - Intronic
931663948 2:64596623-64596645 ATGGCCTCTGGCTCTGTCAGGGG - Intergenic
935926275 2:108073067-108073089 CTGAACTTTCACTCTCCCAGTGG + Intergenic
946157904 2:217818869-217818891 ATGTCCTTCCGCACTGCCAGTGG - Intronic
947552197 2:231054305-231054327 ATGGCATTTCACTCTTACAGGGG + Intergenic
948821921 2:240554247-240554269 GGGGCCTTTCTCTTTCCCAGGGG + Intronic
1169966075 20:11219019-11219041 ATGGCCTCTGCCTCTCCCATGGG + Intergenic
1173170501 20:40719602-40719624 ATTTCCTTTCCCCCTCCCAGGGG - Intergenic
1177695299 21:24563890-24563912 GTGGCCTTCCTCTCACCCAGAGG - Intergenic
1178201121 21:30406624-30406646 ATGGGCTTTGCCTCTACCAGTGG + Intronic
1178726167 21:35053616-35053638 ATGGGCTGTCCCCCTCCCAGAGG + Intronic
1183378144 22:37476979-37477001 TTGGCCTTCCTCTCTCTCAGAGG - Exonic
1184876251 22:47277515-47277537 ATGTCCATTCTCTCTCACAGAGG - Intergenic
950859258 3:16133105-16133127 ATGTGCTTTTGCTTTCCCAGGGG + Intergenic
952035803 3:29199261-29199283 ATCCCCTTTCCATCTCCCAGGGG + Intergenic
952739048 3:36717702-36717724 ATGGCCTTTCTCTTTCCAAAGGG + Intronic
953901620 3:46846922-46846944 ATGCCCCTTCCCTCTGCCAGGGG + Intergenic
957525471 3:81373629-81373651 ATGGCCTTTCTGTCTCCCCCTGG - Intergenic
962477955 3:135773390-135773412 TTTGCCTTTCTCTTTCCCAGAGG - Intergenic
962927890 3:140011935-140011957 ATGGCCTTCAGGTCTCCCAGAGG - Intronic
963914480 3:150845383-150845405 CTGGCCCCTCCCTCTCCCAGAGG - Intergenic
967962781 3:194939215-194939237 AAGCCCTTTTCCTCTCCCAGAGG - Intergenic
969693984 4:8724669-8724691 GTGGCCTCTCGGTCCCCCAGTGG - Intergenic
972287077 4:37659471-37659493 ATGGCATTTCTCACACCCAGTGG + Intronic
980774979 4:137425909-137425931 ATGGCCTTTCATTACCCCAGTGG - Intergenic
982395569 4:154911814-154911836 ATGCCCATTCACGCTCCCAGTGG - Intergenic
984948068 4:184985375-184985397 ATTGCCTCTCCCTCTCCCTGGGG - Intergenic
986340632 5:6786319-6786341 ATGGCCCTGCGCACTTCCAGTGG + Intergenic
992980680 5:82168273-82168295 ATGGCCTTTTGCCTTACCAGAGG + Intronic
1001919141 5:175586958-175586980 ATGGCATTTGGCTCTGACAGAGG + Intergenic
1005765520 6:29007442-29007464 ATGGCATTTGGCTTTCCCAAGGG - Intergenic
1005842016 6:29749719-29749741 TTGGCCTTTTGATCACCCAGGGG - Intergenic
1013040713 6:106430723-106430745 GTGGCCTTTCCCTCTCCATGGGG + Intergenic
1014560762 6:122887591-122887613 ATGGCCTTTAACTTTACCAGAGG + Intergenic
1015841349 6:137480581-137480603 ATTGCCTGTCCCTCTCCCACTGG - Intergenic
1017559779 6:155614839-155614861 ACGGCCTTTCTCTCTGCCATTGG + Intergenic
1019069139 6:169327116-169327138 ATGCCCTTTCTCTCTACCAAAGG + Intergenic
1022834783 7:34103080-34103102 CTGCCCTTCCACTCTCCCAGAGG - Intronic
1026461481 7:70618910-70618932 AAAGCTTTTCCCTCTCCCAGTGG - Intronic
1028700725 7:93776011-93776033 ATGCCCTTTCTCTCTGCCATAGG + Intronic
1032004081 7:128286103-128286125 ATGGCCCCTCTCTCTCCAAGTGG + Intergenic
1034964927 7:155384943-155384965 ATGGCCTTCCCATCTCACAGAGG - Intronic
1035611078 8:964850-964872 ATGGCCTTTGGCTCCGCCTGTGG + Intergenic
1036782679 8:11660284-11660306 GTGGCCTTTCAGTCACCCAGTGG - Intergenic
1041305195 8:56450331-56450353 TTGGCCTTTTGCTCTCCAGGAGG + Intergenic
1043028893 8:75106474-75106496 ATTTCCTGTCTCTCTCCCAGTGG + Intergenic
1044803544 8:95981446-95981468 AGGGGCTTTCCCTTTCCCAGTGG - Intergenic
1051291654 9:15551954-15551976 ATGACCGTTGGCTCTCCCATGGG + Intergenic
1051481196 9:17563232-17563254 ATTGCTTTTCTCTCTCCAAGAGG + Intergenic
1058752997 9:108057722-108057744 ATGGAATTTGGCTCTCCCAGGGG + Intergenic
1061570661 9:131475804-131475826 CTGGACTTTTGCTCTGCCAGTGG - Exonic
1062126996 9:134869302-134869324 AGGACCTTTCCCTCTCCCATGGG - Intergenic
1186586346 X:10877352-10877374 TTGGCCTTTCCCTCTCACTGTGG - Intergenic
1199847421 X:151701235-151701257 TTGGCCTTTGGCTCTTCCCGGGG - Exonic