ID: 1076058226

View in Genome Browser
Species Human (GRCh38)
Location 10:127392728-127392750
Sequence GGGTGGGGAGGTGGGAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4219
Summary {0: 1, 1: 12, 2: 60, 3: 447, 4: 3699}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076058226_1076058239 -5 Left 1076058226 10:127392728-127392750 CCATGCCTCCCACCTCCCCACCC 0: 1
1: 12
2: 60
3: 447
4: 3699
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058226_1076058234 -8 Left 1076058226 10:127392728-127392750 CCATGCCTCCCACCTCCCCACCC 0: 1
1: 12
2: 60
3: 447
4: 3699
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data
1076058226_1076058238 -6 Left 1076058226 10:127392728-127392750 CCATGCCTCCCACCTCCCCACCC 0: 1
1: 12
2: 60
3: 447
4: 3699
Right 1076058238 10:127392745-127392767 CCACCCCCAGCGCCGGGTCGGGG No data
1076058226_1076058236 -7 Left 1076058226 10:127392728-127392750 CCATGCCTCCCACCTCCCCACCC 0: 1
1: 12
2: 60
3: 447
4: 3699
Right 1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076058226 Original CRISPR GGGTGGGGAGGTGGGAGGCA TGG (reversed) Intronic
Too many off-targets to display for this crispr