ID: 1076058234

View in Genome Browser
Species Human (GRCh38)
Location 10:127392743-127392765
Sequence CCCCACCCCCAGCGCCGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076058223_1076058234 11 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data
1076058225_1076058234 9 Left 1076058225 10:127392711-127392733 CCTGGGAGAGCGAAAGGCCATGC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data
1076058226_1076058234 -8 Left 1076058226 10:127392728-127392750 CCATGCCTCCCACCTCCCCACCC 0: 1
1: 12
2: 60
3: 447
4: 3699
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data
1076058219_1076058234 27 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data
1076058224_1076058234 10 Left 1076058224 10:127392710-127392732 CCCTGGGAGAGCGAAAGGCCATG 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1076058234 10:127392743-127392765 CCCCACCCCCAGCGCCGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076058234 Original CRISPR CCCCACCCCCAGCGCCGGGT CGG Intronic
No off target data available for this crispr