ID: 1076058239

View in Genome Browser
Species Human (GRCh38)
Location 10:127392746-127392768
Sequence CACCCCCAGCGCCGGGTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076058223_1076058239 14 Left 1076058223 10:127392709-127392731 CCCCTGGGAGAGCGAAAGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058224_1076058239 13 Left 1076058224 10:127392710-127392732 CCCTGGGAGAGCGAAAGGCCATG 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058227_1076058239 -10 Left 1076058227 10:127392733-127392755 CCTCCCACCTCCCCACCCCCAGC 0: 3
1: 11
2: 93
3: 805
4: 5461
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058225_1076058239 12 Left 1076058225 10:127392711-127392733 CCTGGGAGAGCGAAAGGCCATGC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058226_1076058239 -5 Left 1076058226 10:127392728-127392750 CCATGCCTCCCACCTCCCCACCC 0: 1
1: 12
2: 60
3: 447
4: 3699
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data
1076058219_1076058239 30 Left 1076058219 10:127392693-127392715 CCTGACTCAGACTGAGCCCCTGG 0: 1
1: 1
2: 0
3: 21
4: 236
Right 1076058239 10:127392746-127392768 CACCCCCAGCGCCGGGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076058239 Original CRISPR CACCCCCAGCGCCGGGTCGG GGG Intronic
No off target data available for this crispr