ID: 1076060152

View in Genome Browser
Species Human (GRCh38)
Location 10:127407767-127407789
Sequence TCTTTGATCAGGGGACACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076060152_1076060160 11 Left 1076060152 10:127407767-127407789 CCCCCGTGTCCCCTGATCAAAGA No data
Right 1076060160 10:127407801-127407823 TCAGCAACCACGCCCCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076060152 Original CRISPR TCTTTGATCAGGGGACACGG GGG (reversed) Intronic