ID: 1076060858

View in Genome Browser
Species Human (GRCh38)
Location 10:127412944-127412966
Sequence GACACTGTAGTGACCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076060858_1076060862 9 Left 1076060858 10:127412944-127412966 CCAGGACTGGTCACTACAGTGTC 0: 1
1: 0
2: 4
3: 9
4: 97
Right 1076060862 10:127412976-127412998 CAACAGTGCGGGCAGAACCTAGG No data
1076060858_1076060863 23 Left 1076060858 10:127412944-127412966 CCAGGACTGGTCACTACAGTGTC 0: 1
1: 0
2: 4
3: 9
4: 97
Right 1076060863 10:127412990-127413012 GAACCTAGGCACGTCCAACCTGG No data
1076060858_1076060860 -2 Left 1076060858 10:127412944-127412966 CCAGGACTGGTCACTACAGTGTC 0: 1
1: 0
2: 4
3: 9
4: 97
Right 1076060860 10:127412965-127412987 TCCATTGTCTGCAACAGTGCGGG No data
1076060858_1076060859 -3 Left 1076060858 10:127412944-127412966 CCAGGACTGGTCACTACAGTGTC 0: 1
1: 0
2: 4
3: 9
4: 97
Right 1076060859 10:127412964-127412986 GTCCATTGTCTGCAACAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076060858 Original CRISPR GACACTGTAGTGACCAGTCC TGG (reversed) Intronic
901563683 1:10094194-10094216 GAAACTGTAGTCACTAGTACAGG - Intronic
901752073 1:11416474-11416496 ACCTCTGTAGTGACCAGTCCAGG + Intergenic
902812924 1:18899339-18899361 GACACGGTAGTAACCAATTCCGG + Intronic
904872283 1:33626174-33626196 GGCACTGAAGAGACCAGCCCAGG - Intronic
911065304 1:93782506-93782528 GAGACAGTAGAGTCCAGTCCTGG + Intronic
912551012 1:110485254-110485276 GACACTGAAGAGCTCAGTCCTGG - Intergenic
915290029 1:154877350-154877372 GACAGTGGAGTGGCCAGGCCAGG + Intergenic
922301076 1:224301376-224301398 GATACAGGAGTGACCATTCCTGG + Intronic
922476195 1:225908405-225908427 AAAACTGTAATGACCAGGCCTGG - Intronic
1067258763 10:44667526-44667548 GGCACTGTTGTGACCTGGCCAGG - Intergenic
1068669786 10:59710733-59710755 TACACTGAAGTGACAGGTCCTGG + Intronic
1073592287 10:104768814-104768836 GACACTGGAGTGACCTGTCATGG + Intronic
1076060858 10:127412944-127412966 GACACTGTAGTGACCAGTCCTGG - Intronic
1077586924 11:3460884-3460906 AACACTGTCTTGACCAGTCTGGG - Intergenic
1082031398 11:47606890-47606912 GAGACTGTAGTTACCAGGACAGG + Intergenic
1085258536 11:75191050-75191072 CACACTGCAGTGATCAGTGCAGG + Intronic
1086850067 11:91798656-91798678 GGCACTGTCGTGACCTGACCGGG + Intergenic
1091601787 12:1922353-1922375 GACACTGCAGTGGCCAGGGCTGG + Intergenic
1091871870 12:3898682-3898704 GACAAAGCAGTGATCAGTCCAGG + Intergenic
1094151079 12:27284250-27284272 CACAGTGCAGTGACCACTCCAGG - Intronic
1094225660 12:28042480-28042502 GACCATGAAGTGACCAGTCTGGG + Intergenic
1099293955 12:80806860-80806882 AAAACTGTAGTGACCATTTCAGG - Intronic
1099749572 12:86755710-86755732 GAGGCTGTAGTGACCAGTGATGG - Intronic
1100100615 12:91099652-91099674 GACACTGTAGTGAACAAGACCGG - Intergenic
1102666581 12:114579281-114579303 GGCAGGGTAGTGACCAGTCCAGG - Intergenic
1103333734 12:120173388-120173410 GATACTATAGTGACAAGTTCTGG + Intronic
1108132508 13:47317976-47317998 GACACTGTGGAGACCTCTCCAGG - Intergenic
1109207071 13:59494461-59494483 GACACAGTGGTGATGAGTCCAGG + Intergenic
1110305737 13:73984834-73984856 GATACTGTAGTGAACATTTCTGG - Intronic
1112767351 13:102760057-102760079 TACACTGAAGTGAACAGTTCAGG + Intergenic
1113913642 13:113856983-113857005 GCCACTGCAGTGACCGGCCCAGG + Intronic
1118391769 14:65301966-65301988 GCCTCTGTAGCGACCAGCCCAGG + Intergenic
1118586651 14:67359756-67359778 GACACTGTGGAGGCCAGTTCTGG - Exonic
1121989469 14:98541870-98541892 GACAGTGGAGGGACCAGGCCAGG - Intergenic
1122067625 14:99184648-99184670 GACCCTGTGGTGACCATCCCTGG + Intronic
1129467815 15:75733718-75733740 GACACTGAAATGACCAGTCCAGG + Intergenic
1129719402 15:77869868-77869890 GACACTGAAATGACCAGTCCAGG - Intergenic
1130459522 15:84150883-84150905 GACACTGAAATGACCAGTCCAGG + Intergenic
1130578793 15:85116693-85116715 GACACCCTAGTGGGCAGTCCTGG - Intronic
1134533099 16:15000419-15000441 GACACTGTAGAGATCAGAGCAGG - Intronic
1136145598 16:28314660-28314682 GACACTGGAGTGACATGTCTGGG + Intronic
1140662589 16:77201637-77201659 AACACTCCAGTGACCATTCCTGG - Exonic
1142979931 17:3665832-3665854 GAGACTGGAGTGTCCAGTGCAGG + Intronic
1144123645 17:12180741-12180763 GACACTGTAGTAAGCATTTCGGG - Intergenic
1147923414 17:43932504-43932526 GCCACCGCAGTGCCCAGTCCTGG - Intergenic
1148741416 17:49895152-49895174 GACACTGGAAGGATCAGTCCTGG + Intergenic
1150201595 17:63362674-63362696 GGCACTGTTGTGACCCGGCCAGG - Intronic
1152708010 17:81855339-81855361 GACCCTGTAGAGCCCAGGCCAGG + Intronic
1153759161 18:8313512-8313534 GACACAGCAGTGATCAGTGCAGG + Intronic
1159011333 18:63061656-63061678 GACACTCTAGAGCTCAGTCCTGG + Intergenic
1163187007 19:15645867-15645889 GACACTGCACTGGCCACTCCAGG + Intronic
1165613358 19:37176532-37176554 GACTCTGTAGTTATCTGTCCTGG + Intronic
1166379403 19:42347990-42348012 GACACTGAAGTGTCCAGTCCTGG + Intronic
927638600 2:24833062-24833084 GCCACTGTGGTGGCCAGGCCAGG - Intronic
929024014 2:37581799-37581821 GACACTTTAGAGACCAGGCCTGG + Intergenic
931106071 2:59057281-59057303 GACACTGTTGTGAGAAGGCCTGG + Intergenic
935577111 2:104722597-104722619 GACCCTGTAATGACCTCTCCTGG + Intergenic
937987263 2:127643598-127643620 GACTCTGTAGTGACAGTTCCTGG - Intronic
940788331 2:158005744-158005766 GACACTGCAGGGACCAGTGGGGG + Intronic
941404753 2:165074577-165074599 GGCACTGTGGTGACCTGGCCAGG + Intergenic
948965455 2:241376230-241376252 GACACTGCAGTGCCCACTTCTGG - Intronic
1174979528 20:55377855-55377877 GACCCTGCAGTGACCACTACAGG - Intergenic
1181892303 22:26074227-26074249 CACACTGTAGTGACCTGTCAAGG + Intergenic
1184212419 22:43043785-43043807 GTAACTGTGGTGACCAGGCCTGG - Intronic
950114332 3:10440800-10440822 GACAGTGTAGGCACCAATCCTGG + Intronic
952743760 3:36759384-36759406 GCCACTGTAGTCACCAGTGCAGG - Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
956977950 3:74603358-74603380 GATACTGTGGTGCCCAATCCAGG - Intergenic
961667909 3:128505047-128505069 GACACTGCAGTTTCCAGCCCAGG + Intergenic
961958284 3:130826860-130826882 GACAAAGAAGTGACCAGTCCAGG - Intergenic
972105695 4:35482975-35482997 GACTCTGGAGTCACCAGACCAGG + Intergenic
972106397 4:35494167-35494189 GACACTGTTGCAACCCGTCCAGG + Intergenic
973534594 4:51868052-51868074 GGCACTGTCGTGACCTGACCAGG - Intronic
973942295 4:55923433-55923455 CACACTGAAGTGCCCAGTTCTGG - Intergenic
975066290 4:70068581-70068603 GAAGCTTTAGTGGCCAGTCCAGG + Intergenic
975757765 4:77587950-77587972 GACAGGGTAGTGACAAGTGCTGG - Intronic
977348291 4:95846044-95846066 GACACTCTGATCACCAGTCCTGG + Intergenic
978499125 4:109389689-109389711 GACACTTTGATGATCAGTCCTGG - Intergenic
980877065 4:138672401-138672423 GACCCTGTAGTGCCAAGTCCAGG + Intergenic
983253203 4:165368245-165368267 GCCACTGCAGTGTCCTGTCCAGG - Intronic
984293229 4:177821973-177821995 GCGTCTATAGTGACCAGTCCTGG + Intronic
993028942 5:82681113-82681135 GACCTTGGTGTGACCAGTCCAGG + Intergenic
993588422 5:89761559-89761581 GCCACTGTAATCTCCAGTCCAGG + Intergenic
994380418 5:99064316-99064338 TACACTGTGGGGACCAGTGCAGG + Intergenic
997921670 5:137985730-137985752 GACACTGTAGTGTCTAGTACTGG - Intronic
999107418 5:149086112-149086134 CACTCTGTAGGAACCAGTCCAGG - Intergenic
1010567234 6:77431173-77431195 GACACTGTACTCACCCATCCTGG + Intergenic
1011056482 6:83209439-83209461 GACACTGTATTGGACAGTGCAGG - Intergenic
1015876067 6:137824123-137824145 AACACTGTAGTCACCAGACTTGG - Intergenic
1018491948 6:164302999-164303021 GACACTGTTATGGCCACTCCAGG + Intergenic
1028338397 7:89686935-89686957 GACACTGTAGTTACCAGGAAAGG + Intergenic
1028527201 7:91799746-91799768 GACACTGCAGTACCCAGTGCAGG - Intronic
1029269326 7:99367378-99367400 GACACTATAGGGACCAGGCAGGG - Intronic
1030006103 7:105121730-105121752 GCAACTGTACTGGCCAGTCCTGG + Intronic
1032418808 7:131761185-131761207 GATACTGGACTGACCATTCCTGG + Intergenic
1033376902 7:140770549-140770571 CACAATGTACTGACCATTCCTGG + Intronic
1033432066 7:141298647-141298669 GAGATAGTACTGACCAGTCCAGG - Intronic
1035727554 8:1834141-1834163 GATACTGTGGTGGCCGGTCCGGG + Intronic
1037587546 8:20288395-20288417 GAAACAGCAGTGCCCAGTCCAGG + Intronic
1047719197 8:127623285-127623307 GACACAGTGGTGAGCATTCCAGG + Intergenic
1048367604 8:133752254-133752276 GACACTTTGGTGGCCTGTCCAGG + Intergenic
1049484304 8:142845265-142845287 GACACTGCTGTGAGCAGCCCAGG - Intronic
1055819960 9:80250602-80250624 GATACTGTATTGAACAGTACAGG + Intergenic
1059038238 9:110782917-110782939 GTCACAGTGGTGACCAGGCCTGG + Intronic
1187707157 X:22020355-22020377 GACTCTGTAGTTACTAGTCATGG - Intergenic
1190492849 X:51000440-51000462 TGCAATGTAGTGAACAGTCCAGG - Intergenic
1193459233 X:81770781-81770803 GACACTGTAGCGAACAGTATGGG + Intergenic
1195821033 X:108945583-108945605 GAGCCTGCAGGGACCAGTCCTGG - Intergenic
1197540758 X:127757000-127757022 GACACTGTAGTGAATACTCTAGG + Intergenic
1199689193 X:150294633-150294655 GACAGTGTAGATTCCAGTCCAGG - Intergenic
1200424497 Y:3006394-3006416 GACACTGGAGAGACCAGTGAGGG - Intergenic