ID: 1076063349

View in Genome Browser
Species Human (GRCh38)
Location 10:127430055-127430077
Sequence CTGTAGGTGGGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1299
Summary {0: 1, 1: 1, 2: 5, 3: 142, 4: 1150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076063349_1076063359 7 Left 1076063349 10:127430055-127430077 CCCTCTCCCCTCCCCACCTACAG 0: 1
1: 1
2: 5
3: 142
4: 1150
Right 1076063359 10:127430085-127430107 ACCCGCTGGCCACCCAGACCCGG No data
1076063349_1076063358 -7 Left 1076063349 10:127430055-127430077 CCCTCTCCCCTCCCCACCTACAG 0: 1
1: 1
2: 5
3: 142
4: 1150
Right 1076063358 10:127430071-127430093 CCTACAGTCACAACACCCGCTGG No data
1076063349_1076063361 8 Left 1076063349 10:127430055-127430077 CCCTCTCCCCTCCCCACCTACAG 0: 1
1: 1
2: 5
3: 142
4: 1150
Right 1076063361 10:127430086-127430108 CCCGCTGGCCACCCAGACCCGGG No data
1076063349_1076063365 19 Left 1076063349 10:127430055-127430077 CCCTCTCCCCTCCCCACCTACAG 0: 1
1: 1
2: 5
3: 142
4: 1150
Right 1076063365 10:127430097-127430119 CCCAGACCCGGGAGAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076063349 Original CRISPR CTGTAGGTGGGGAGGGGAGA GGG (reversed) Intronic
900158909 1:1214187-1214209 GTGGAGGAGGGGAGGGGAGAGGG + Intergenic
900365249 1:2309586-2309608 CTGCCGGGGGGCAGGGGAGACGG + Exonic
900561114 1:3307274-3307296 CTGCTGGTGGGGAGGTGACATGG - Intronic
900658538 1:3772084-3772106 GTGTGGGTGGGGAGCAGAGAAGG - Intergenic
900738044 1:4311646-4311668 GAGGAGGTCGGGAGGGGAGACGG - Intergenic
900813377 1:4825236-4825258 CTGCAGGTGGGCTGGGGTGAGGG - Intergenic
900991139 1:6099002-6099024 GTGTAGGGGGAGAGGGGAAAGGG + Exonic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
901151610 1:7107024-7107046 TGGCAGGTGGGGTGGGGAGAGGG + Intronic
901509407 1:9708915-9708937 CTAGAGGCGGGGAAGGGAGAAGG + Intronic
901640556 1:10690989-10691011 CGGGAAGGGGGGAGGGGAGATGG - Intronic
901796202 1:11681018-11681040 CGGTACTGGGGGAGGGGAGAGGG - Exonic
901930933 1:12595773-12595795 GTGCAGCTGGGGAGGGGACAGGG + Intronic
902203750 1:14852489-14852511 CTGCAGGTGGGGAGGGGGCTGGG - Intronic
902480255 1:16707855-16707877 CGGGCGGTGCGGAGGGGAGACGG - Intergenic
902552244 1:17225983-17226005 CTGTTGGTGGGGTGGAGAAAGGG + Intronic
902608413 1:17582261-17582283 CTCTTGGTGGGGAGAGGAAAGGG - Intronic
902866585 1:19284120-19284142 CAGTAGCTGGGAAGGGGGGACGG + Exonic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903021772 1:20400018-20400040 CTGTAGGAAGGCAGGGGAGGAGG - Intergenic
903115420 1:21175886-21175908 CCTTAGGGGAGGAGGGGAGAAGG + Intronic
903129351 1:21268627-21268649 CTCTAGGCGGAGAGGGGAGAAGG - Intronic
903272433 1:22198370-22198392 AAGTAGGTGGGGAAGGGGGATGG - Intergenic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903778238 1:25806584-25806606 CTGTAGGCGGGGAGGGAGTAGGG + Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904175417 1:28624944-28624966 ATGTTTGTGGGTAGGGGAGAAGG - Intronic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
904304083 1:29575797-29575819 CTGGAGGAGGGCAGGGAAGAGGG - Intergenic
904320985 1:29697691-29697713 CTGCAGGAGGGGAGGTGAGGTGG + Intergenic
904322766 1:29707722-29707744 CAAATGGTGGGGAGGGGAGAAGG - Intergenic
904417775 1:30373623-30373645 ATGGAGGTGGGCAGTGGAGACGG + Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904472079 1:30742237-30742259 CTGCAGGTGGTGAGAGCAGATGG - Intronic
904542131 1:31240012-31240034 CCGCCGGAGGGGAGGGGAGAGGG + Intergenic
904622902 1:31786046-31786068 CTGGAGGGTGGGAGGGGACACGG - Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905002938 1:34687649-34687671 CTGTAGGTGGGAATGGAAAATGG - Intergenic
905011704 1:34751550-34751572 CTGGAGGTGGGAAGGGTGGAAGG - Intronic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905336058 1:37245349-37245371 CTGCAGGTGGGGCTGGGAGAAGG - Intergenic
905904220 1:41606345-41606367 CTGAAGGTGGGCAGGAGGGAAGG - Intronic
905966778 1:42104896-42104918 CTGCAGTTTGAGAGGGGAGAAGG - Intergenic
906198530 1:43944989-43945011 GTGGTGGTGGGCAGGGGAGATGG - Intergenic
906210215 1:44008624-44008646 CTGCAGGAGGGGAGGGGTGGGGG + Intronic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
906490784 1:46266844-46266866 CTGGAGGTGGGGCAGGGAAAGGG + Intronic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
906839020 1:49116367-49116389 CTGTTGGCGGGGTGGGGATATGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
907309103 1:53529278-53529300 CTGCAGGTGAGGAGCGGAGGTGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907431715 1:54416040-54416062 CTGTAGGAGGGGTGGCTAGATGG - Intergenic
907589008 1:55647745-55647767 TGGGAGGTGAGGAGGGGAGAAGG + Intergenic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
907679683 1:56551534-56551556 CTTTGAGTGGGGAGGGGAGGAGG - Intronic
907696041 1:56730320-56730342 AGGGAGGAGGGGAGGGGAGAGGG + Intronic
907887784 1:58609467-58609489 CAGTAGGTGGGGAGGAGGGAAGG - Intergenic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908571558 1:65416709-65416731 CTGTAGGTGGGTATTGGAGCTGG + Intergenic
908586323 1:65573820-65573842 CTGGAGTTGGGGAGTGGTGATGG + Intronic
908935048 1:69365021-69365043 CTGGAGGTGGAGAGGAGATAGGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909564406 1:77038895-77038917 CTGGGGGTGGGCAGGGGTGATGG + Intronic
910088665 1:83435885-83435907 CTGTAGGAGGGTGGGGGAGCTGG + Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910643403 1:89488824-89488846 CTGCTGCTGGCGAGGGGAGAGGG - Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
911064231 1:93773436-93773458 GTGCAGGTGGGAAGGGGAGGGGG + Intronic
911618099 1:100037290-100037312 ATGTAGGTGGGGAAAAGAGAGGG - Intergenic
911693328 1:100860303-100860325 GTGTAGGGGGAGAGAGGAGAGGG + Intergenic
912016905 1:105050174-105050196 CAGAAGCTGGGGAGGGGAGGAGG - Intergenic
912245699 1:107959839-107959861 GTGTATGTGGGGAGAGGGGAAGG - Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
912814134 1:112815451-112815473 GTGAAGGTGAGGAGGGGAGAAGG - Intergenic
913147493 1:116006670-116006692 CAGAAGGTGGGGAGAAGAGAAGG - Intronic
913189899 1:116404603-116404625 CTCTATGGGGGGAGGGGGGAGGG + Exonic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
914320575 1:146555548-146555570 CTGGAGGTGGGAAGGGTAGTGGG + Intergenic
914862629 1:151399304-151399326 ATGAAGGTGGGGTGGGGAGGTGG - Intergenic
914959602 1:152194680-152194702 GGGGGGGTGGGGAGGGGAGAGGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915360360 1:155282835-155282857 GAGGAGGTGGGGTGGGGAGATGG + Exonic
915526822 1:156481100-156481122 CTGTCAGTGGGGAGGGGCCAGGG - Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
915893974 1:159796870-159796892 CTGAAGGAGGGCAGGTGAGAAGG + Intergenic
916683710 1:167126355-167126377 CCGGAGGTGGGGAAGGGAGGAGG + Exonic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917421249 1:174866079-174866101 GTGAAGGAGAGGAGGGGAGAGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
918092433 1:181308997-181309019 CTGTAGGTGGAGGGTGGTGATGG + Intergenic
918177825 1:182060895-182060917 CTGGAGGTGGGGTGGGGAGCGGG - Intronic
918215414 1:182389334-182389356 CTTTTGGTGGGGAGGGGCGGTGG - Intronic
918277284 1:182965706-182965728 CTGTATGTGTGGTGGGGAGGTGG - Intergenic
918841773 1:189549839-189549861 GGGTAGGAGGGGAGGGGAGAAGG + Intergenic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
919923583 1:202180470-202180492 CTGGAGATGGGGAGGAGAGCTGG + Intergenic
920035086 1:203060391-203060413 CTGGAGGTGGGTGGGGCAGAGGG - Exonic
920041286 1:203099306-203099328 CTGGGGGTGGGGTAGGGAGAGGG - Intronic
920118142 1:203635924-203635946 CTGTGGGTGGGGAGCAGTGAGGG - Intronic
920118502 1:203638115-203638137 ATGGAGGAGGGGAGGGGAGATGG + Intronic
920122687 1:203670616-203670638 CTATAGGGTGGGAAGGGAGAAGG - Intronic
920142074 1:203823538-203823560 TGGTAAGTGGGGAAGGGAGAAGG - Intronic
920160855 1:203996719-203996741 CTGTAGGTTGGGAGGGGGTAGGG + Intergenic
920285315 1:204874647-204874669 GCCTAGGTGGGGAGGGTAGAAGG - Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
921264880 1:213414103-213414125 CTGGAGGTGGGGATGGGGGAAGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922317696 1:224457038-224457060 CTGGATGTGGCGAGGGGAGACGG + Intronic
922479340 1:225928205-225928227 CTGAAGTTGAGGAGAGGAGAGGG + Intergenic
922536408 1:226384249-226384271 CTGGCGGTGGGGTGGGGAGAGGG + Intronic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922960870 1:229644630-229644652 CTGTAGGTGGGCAGGAGAGTGGG + Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923027685 1:230219049-230219071 CAGATGGTGGAGAGGGGAGATGG - Intronic
923046975 1:230362648-230362670 CTTTAGCTGGGGTCGGGAGACGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923448219 1:234092395-234092417 GTGTAGGAGGGGGTGGGAGAGGG - Intronic
923511118 1:234654680-234654702 CTGTTACTGGGGATGGGAGAGGG + Intergenic
924775566 1:247112734-247112756 CTGTAGGTGGGGAGGCAGGCAGG + Intergenic
1062928951 10:1339959-1339981 CTGGGGGTGGGCAGTGGAGAGGG + Intronic
1063082593 10:2782665-2782687 AGGTAGGAGGAGAGGGGAGACGG - Intergenic
1063119457 10:3094540-3094562 GTGTTGGTGGGGAGGTGAGCAGG + Intronic
1063219586 10:3954365-3954387 CTGTTGGTGGGTAGGGGGCAGGG + Intergenic
1063305454 10:4895234-4895256 GTGTAGCTGGGGAGGGGGGTTGG - Intergenic
1063940179 10:11120551-11120573 CTTCTGGTGGGGAGGGGAAAGGG - Intronic
1064364371 10:14693748-14693770 GGGTAGGTGGGGAGAAGAGATGG - Intronic
1064680437 10:17806400-17806422 CTGGAAGTGGGGAGTGGAGTGGG + Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1064974834 10:21102970-21102992 CTGGAAGTGGGGTGGGGGGAGGG - Intronic
1065204548 10:23344335-23344357 CGGGAGGAGGGGAGTGGAGAGGG + Intronic
1065815848 10:29481729-29481751 CTGTAGGGTGGGAGGGGGGTTGG + Intronic
1065965420 10:30766630-30766652 CTGGCGCTGGGGAGGGGACAGGG - Intergenic
1066220655 10:33334706-33334728 CTGTGGGTGGGAGGGGGAGGAGG + Exonic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1067019072 10:42779598-42779620 CTGGAGCTGGTGAGGGGAGTGGG + Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1068585810 10:58796923-58796945 CTGTATGAGGGGTGGGGAGGGGG + Intronic
1068965732 10:62910817-62910839 CTATAGGTGGGGGAGGGAGTGGG - Intronic
1069380255 10:67836192-67836214 CTGTCGGGGGGTGGGGGAGAAGG + Intronic
1069583090 10:69578340-69578362 CGGTAGGTGGGGGTGGAAGACGG - Intergenic
1069649591 10:70035777-70035799 CAGTAGGTGGAGATGGGAGAAGG - Intergenic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069893224 10:71664882-71664904 AGGAAGATGGGGAGGGGAGAGGG - Intronic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070729146 10:78813413-78813435 AGGTAGGTGGGGAGGGGACAGGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070838985 10:79470132-79470154 TTCTAGGTGGGGAGGGGTGGGGG + Intergenic
1070839826 10:79476823-79476845 CTGAAGGTGATGAGGGGAAAAGG + Intergenic
1071146255 10:82576387-82576409 GTCTAGGAGGGGAGGGGAGCAGG - Intronic
1071283566 10:84124623-84124645 CTTTAGGTTGGGAGGGGAACAGG + Intergenic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071480424 10:86061087-86061109 CAGGAGGTGGGGGTGGGAGAAGG - Intronic
1071574630 10:86716434-86716456 GTGTAGGTGGGGACAGGTGAGGG - Exonic
1071690303 10:87811632-87811654 TTGATGGTGGTGAGGGGAGATGG + Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072416090 10:95248162-95248184 GGGGAGGTGGGGAGGTGAGAAGG - Intronic
1072447812 10:95514950-95514972 CTGTAGTGTGGGAGGGGAGTGGG - Intronic
1072635518 10:97175492-97175514 CTGTTGGTGGGGATGTGAAACGG - Intronic
1073335518 10:102705098-102705120 CTGGAGCTGGGGAGGGGGAATGG - Intronic
1074326364 10:112455286-112455308 GTGGAGGAGGGGAGGGGAGGGGG - Intronic
1074388280 10:113034951-113034973 GGGAAGGAGGGGAGGGGAGAGGG - Intronic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075329609 10:121564021-121564043 CTTTAGCTGGGGAGGGGCCAGGG - Intronic
1075490468 10:122863584-122863606 GTGTATGTGAGCAGGGGAGAGGG - Intronic
1075553236 10:123409575-123409597 CTGGAGTTGGGGAGGGGGGTTGG - Intergenic
1075657522 10:124172113-124172135 CCGCAGGTGGGCAGGGGAGGGGG - Intergenic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1075895345 10:125990109-125990131 CTGTACCTGGGGAGGAGGGAAGG - Intronic
1076038957 10:127226847-127226869 GTGAAGGTGGGGATGGGAGCGGG - Intronic
1076039780 10:127236329-127236351 GGGAAGGAGGGGAGGGGAGAGGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076174317 10:128355430-128355452 GAGTAGGTGAGGAGGAGAGAAGG + Intergenic
1076248270 10:128964486-128964508 ATATAGGAGGAGAGGGGAGACGG - Intergenic
1076642928 10:131931115-131931137 CTGATGGAGGGGAGAGGAGAGGG - Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076802216 10:132835951-132835973 CGGGAAGTGGGGAGGGGAGTGGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077003009 11:334421-334443 CAGCCTGTGGGGAGGGGAGAGGG - Intergenic
1077020188 11:413879-413901 GGGAAGGTGGGGAGGGGAGAGGG - Intronic
1077020218 11:413989-414011 GGAAAGGTGGGGAGGGGAGAGGG - Intronic
1077020266 11:414142-414164 GGAAAGGTGGGGAGGGGAGAGGG - Intronic
1077020294 11:414226-414248 GGAAAGGTGGGGAGGGGAGAGGG - Intronic
1077020322 11:414310-414332 GGAAAGGTGGGGAGGGGAGAGGG - Intronic
1077037683 11:503170-503192 GGGTGGGTGGGGTGGGGAGAGGG + Exonic
1078159413 11:8827958-8827980 CTGGAGGTGGGGAGGGGGAACGG + Intronic
1078182374 11:9022848-9022870 CGGGAGGTGGGGAGGTGAGAGGG - Intronic
1078222044 11:9359594-9359616 CTGTAACTTGAGAGGGGAGATGG - Intergenic
1078324754 11:10370395-10370417 CTGGAGCTGGAGAGGGCAGAGGG + Intronic
1078444787 11:11395974-11395996 GTGGAGATGGGGAGGGGAGAGGG + Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078754451 11:14195755-14195777 CTGTTGGTGGGGAGTGGATTTGG + Intronic
1078907877 11:15704364-15704386 CTGGAGGGTGGGAGGGGAGCAGG - Intergenic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1079319366 11:19438988-19439010 CTGGAATTGGGGAGTGGAGAGGG + Intronic
1079773675 11:24496949-24496971 CTGGAGGCGGCGCGGGGAGAGGG - Intronic
1079937977 11:26641521-26641543 CTATAGGTGGGGAGAGGGGAAGG + Intronic
1081038176 11:38176698-38176720 CTCTCAGTGGAGAGGGGAGATGG - Intergenic
1081621268 11:44620271-44620293 TTGTAGGGGGAGAGGGGAGGGGG + Exonic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1081877532 11:46419804-46419826 ATGAAGGTGGGGAGGGAGGAAGG + Intronic
1082913214 11:58400827-58400849 GTGTACATGGGGTGGGGAGAGGG + Intergenic
1083196530 11:61091837-61091859 CTGTTGGTGGGGGGTGGGGAGGG - Intergenic
1083285454 11:61655978-61656000 GTGGAGTTGGGCAGGGGAGAAGG - Intergenic
1083570489 11:63758992-63759014 CTTGAGGTGGGCAGGGGAGAGGG - Exonic
1083584557 11:63847322-63847344 TGGTAGGAGAGGAGGGGAGATGG + Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083691177 11:64409790-64409812 AAGGAGGCGGGGAGGGGAGAGGG - Intergenic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1083923434 11:65792473-65792495 CTGGGGGTGGGCAGGGGCGATGG - Intronic
1084129011 11:67119206-67119228 CTGGAGGAGGGGTGGGGAGGTGG + Intergenic
1084273365 11:68040334-68040356 CTGCAGGTGGGCAGGGCAGGGGG - Intronic
1084345186 11:68542241-68542263 CTGTAGGTGGGGATGTGATAGGG + Intronic
1084359819 11:68661923-68661945 CTGTTGGCTGGGAGGGGAGCTGG + Intergenic
1084364738 11:68690239-68690261 CTGGTGGTGGGGAGGAGGGATGG + Intronic
1084394302 11:68898746-68898768 CTGAGGGTGGGGAGGGGAAGTGG - Intronic
1084441853 11:69179119-69179141 GGGTAGGTGGGGAGAAGAGAAGG + Intergenic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084679081 11:70655382-70655404 ATGTAGCTGGTGAGTGGAGAAGG - Intronic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1084898615 11:72293616-72293638 CTGTCGGTGGGGAGGTGAAGTGG + Intronic
1084920296 11:72464287-72464309 ATATATGAGGGGAGGGGAGATGG - Intergenic
1084927539 11:72525528-72525550 CTGCAGATGGGAAGGAGAGAAGG - Intergenic
1084971713 11:72775728-72775750 CTGGAGGTGGGGGATGGAGAGGG - Intronic
1085063646 11:73472097-73472119 GTGGAGATGGGGCGGGGAGAGGG - Intronic
1085093667 11:73741139-73741161 CTGTTGGGGGGGTGGGGGGAAGG - Intronic
1085310509 11:75513923-75513945 CTGTCGGTGGGAAGTGGTGAGGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085704919 11:78778315-78778337 ATGTATGTGGGGCGGGGGGAGGG + Intronic
1085899685 11:80684056-80684078 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1086436169 11:86782885-86782907 CTTGGGGTGGGGAGTGGAGAAGG + Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086887620 11:92223846-92223868 GTGTAGGTGGCGAGTGGAGAGGG + Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087141723 11:94770552-94770574 CTGCAGGTGGATAGGAGAGAAGG + Intronic
1087162047 11:94958669-94958691 CTTTAGGAGGTGAGAGGAGAAGG - Intergenic
1087933449 11:104004184-104004206 CTGTAGAAGGGGTGGGGAGAGGG + Intronic
1088266530 11:107992922-107992944 TGGATGGTGGGGAGGGGAGATGG - Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1088900832 11:114115792-114115814 CCAGAGGAGGGGAGGGGAGAAGG + Intronic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089191687 11:116658575-116658597 CCGTAAGTGGGGAGAGAAGAGGG - Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089377800 11:118007097-118007119 GTGGGGGTGGGGAGTGGAGAAGG - Intergenic
1089399458 11:118156143-118156165 CCCTAGGAGGGCAGGGGAGAAGG - Intergenic
1089771795 11:120808509-120808531 CTGTTGGTGAGGAGAGGCGATGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090039903 11:123281611-123281633 CTGTCGGGGGGTAGGGGACAAGG + Intergenic
1090065488 11:123499706-123499728 ATGGTGGTGGGGTGGGGAGATGG + Intergenic
1090260307 11:125314563-125314585 CAGTCAGTGGGGAGGGGACAAGG + Intronic
1090305057 11:125684138-125684160 CGGCAGGTGGGGCGGGGAGGTGG + Intergenic
1090306210 11:125693386-125693408 GAGTAAGTGGGTAGGGGAGAAGG - Intergenic
1090497704 11:127230771-127230793 CGGTATGGGGGGAGAGGAGATGG + Intergenic
1090701158 11:129296692-129296714 CTGGAGGTGGGGAGGAGTGAGGG + Intergenic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091300504 11:134504160-134504182 GTGTGGGTGGGGTGGGGAAAGGG + Intergenic
1092057047 12:5516313-5516335 TTTTCGGTTGGGAGGGGAGAGGG - Intronic
1092135758 12:6145894-6145916 CTGCAGCTGAGGAGTGGAGATGG - Intergenic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092971518 12:13700101-13700123 CTGTCTGTGGGGAGGTGGGATGG + Intronic
1093523469 12:20077072-20077094 CTGTCGGTGGTGAGGGGCAAGGG + Intergenic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093897653 12:24592923-24592945 GCATAGGTGGGGAGGAGAGAAGG + Intergenic
1094174082 12:27524117-27524139 CTGCAGGGAGGGAGGAGAGAAGG + Intronic
1095403457 12:41841377-41841399 CCCTAGCTGGGGAAGGGAGAAGG - Intergenic
1095493591 12:42761480-42761502 TGTTAGGTGGGGAGGGGGGAAGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095837747 12:46656560-46656582 CTGAAGGTAGGGGTGGGAGAGGG + Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096080765 12:48830855-48830877 CAGTAGGAGGACAGGGGAGATGG - Intronic
1096197129 12:49655917-49655939 CTGTTATTGGTGAGGGGAGAAGG - Intronic
1096602322 12:52738180-52738202 CGGGGGGTGGGGAGGGGGGAGGG + Intergenic
1096650678 12:53060652-53060674 CTGTAGGGTGGAAGGGCAGATGG - Intronic
1096673427 12:53213701-53213723 CTGGAGGTGGGGGGTGGAGGAGG + Intronic
1096722292 12:53532323-53532345 CTAAAGGTGGGGAGAGGAGATGG + Intronic
1096883654 12:54694894-54694916 CTGTTGGGGGGTAGGGGACAAGG + Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097214325 12:57398110-57398132 GTGGGGGTGGGCAGGGGAGAGGG + Intronic
1097246357 12:57609834-57609856 GTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1097261145 12:57720863-57720885 CTCCAGGTGGGGAGGGCACAGGG + Exonic
1097267166 12:57752600-57752622 CTGCAGGGGGGGAGCGGTGAGGG + Intronic
1097444376 12:59649943-59649965 TTTTTGGTGGGGAGGGGGGATGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098374527 12:69799869-69799891 TTTTTGGTGGGGATGGGAGAAGG + Intronic
1098512979 12:71341014-71341036 CTCTTGGTGGGGTGGGGAGAGGG - Intronic
1099614696 12:84919575-84919597 CTTGTGGTGGGGAGGGGGGAAGG - Intergenic
1099730060 12:86489275-86489297 CTCTCAGTGGGGAGGGGAGCTGG - Intronic
1099833550 12:87876841-87876863 CTGTTGGGGGGTAGGGGAGTAGG + Intergenic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1100329647 12:93571550-93571572 CTGGAGGTGGGAAGGAGAGAGGG - Intronic
1100671197 12:96814702-96814724 CTGTTGGTGGGTTGGGGACAAGG - Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101091101 12:101286681-101286703 CAGTAGCTGGAGAGGAGAGATGG - Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101921988 12:108940704-108940726 ATTTTGGTGGGGAGGGGATAGGG - Intronic
1101972428 12:109324868-109324890 CTGTTGGAGGGTAGGGGAAAAGG - Intergenic
1102453765 12:113058557-113058579 CTGGAGGTGAGGCAGGGAGATGG - Intronic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103244946 12:119448661-119448683 ATGGCGGTGGGGAGGGGAGGGGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1103949034 12:124541599-124541621 GAGCAGGTGGGGAGTGGAGATGG + Intronic
1104075621 12:125387145-125387167 CTGGGGGTGGGGCGGGGAGATGG + Intronic
1104288097 12:127443792-127443814 GTGGAGGGTGGGAGGGGAGAGGG - Intergenic
1104440873 12:128792127-128792149 CTGGAGGTGGGGGAGGGGGAGGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104515155 12:129418554-129418576 CTGTTGGTGGGTGGGGGACAAGG + Intronic
1104630858 12:130400962-130400984 CTTTTGGTGGGAAGGTGAGATGG + Intronic
1104676851 12:130716979-130717001 CTTGGGGTGGGGAGGGGAGCCGG - Intergenic
1104742267 12:131186928-131186950 CGGAAGCTGGGGAGGGTAGAGGG + Intergenic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104931704 12:132342518-132342540 GAGCAGGTGGGCAGGGGAGACGG - Intergenic
1104975336 12:132549629-132549651 AGGCAGGCGGGGAGGGGAGAGGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1106925405 13:34607895-34607917 CTGATGGTGGGAAGGAGAGAAGG - Intergenic
1107169003 13:37317402-37317424 CTGTAGGTGGGGAGGCTTCAGGG + Intergenic
1107332717 13:39319291-39319313 CTGGAGTTGGGGTGGGGTGATGG - Intergenic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1108533745 13:51350791-51350813 TGGGAGGTGGGGAGGGGAGCTGG - Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108978325 13:56478395-56478417 CTGAAGGTGGGGATAGGTGATGG + Intergenic
1109582229 13:64355692-64355714 GTGTGGGTGGGGTGGGGAGGTGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110082722 13:71336273-71336295 CTAGAGGTGGGGCAGGGAGAAGG - Intergenic
1110388056 13:74937781-74937803 CTGTAGGTGGGGTGCAGGGAGGG - Intergenic
1110425034 13:75357473-75357495 CTGGAGTTGGGGAGGTGAGAAGG - Intronic
1110739549 13:78978377-78978399 GTATAGGTGGGGAGGGGAGAGGG + Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111610947 13:90605662-90605684 CTGTAGGCTGTGTGGGGAGATGG - Intergenic
1111640081 13:90957597-90957619 GTGGGGGTGGGGGGGGGAGAGGG - Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112319244 13:98392110-98392132 CTGCCTCTGGGGAGGGGAGAAGG - Intronic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1113102069 13:106731981-106732003 CTGTAGTTTGGGAGAGGAAAGGG - Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113467997 13:110525485-110525507 CTGCTGGTGGGGAGGTGAGCGGG - Intronic
1113923047 13:113925151-113925173 CGGTAGGTGGGAAGGAGACAGGG - Intergenic
1114487575 14:23072060-23072082 CTGCAGGTAGGGAGGTGGGATGG + Intronic
1114544333 14:23487403-23487425 CTGTTGGTGGGGGGGGGGGGGGG + Intronic
1114652754 14:24296619-24296641 CTGAAGGTAGGGAGGTGTGAGGG + Intronic
1114990173 14:28276815-28276837 CTCTAGGTGGGAAGAGGGGAGGG + Intergenic
1115510026 14:34129788-34129810 CTATGGGTGGGGAAGGGAGGTGG + Intronic
1115867723 14:37766942-37766964 TGGGATGTGGGGAGGGGAGAGGG - Intronic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117614604 14:57520721-57520743 CTGTTGGGGGTGGGGGGAGATGG - Intergenic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118600321 14:67467449-67467471 CTGTGGGTGGGAAGGAGGGAGGG + Intronic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118835245 14:69473351-69473373 CTGCAGCTGGGGCGGGGAGAGGG - Intergenic
1119182532 14:72614462-72614484 CAGTAGCTGGGAAGGGAAGAGGG - Intergenic
1119562675 14:75603468-75603490 CTGTCAGTGGGAAGGGGAGCTGG - Intronic
1119725640 14:76920431-76920453 CTGGAGGTGGGGGGTGGACATGG - Intergenic
1119741695 14:77017913-77017935 CTTTAGCTGTGGAGGAGAGATGG + Intergenic
1120094976 14:80378353-80378375 CTGGAAGTGGGGAGGGGACTTGG + Intronic
1120255222 14:82110101-82110123 CTCCAGGAGGGGAAGGGAGAGGG + Intergenic
1120483129 14:85077499-85077521 CTGTTGGGGGGATGGGGAGAGGG - Intergenic
1120860926 14:89254394-89254416 CTGTAAGGGAGGTGGGGAGAAGG + Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121447696 14:93988701-93988723 CGGAAGGAGGGGATGGGAGAGGG + Intergenic
1121520117 14:94580553-94580575 CTGCAGGTGGGGTGTGGAGTTGG - Intronic
1121657602 14:95609001-95609023 CTGTTGGTGGGGATGTGAAATGG - Intergenic
1122081046 14:99268272-99268294 GTGGCGGTGGGGAGGGGAGAGGG - Intronic
1122251855 14:100445535-100445557 CTGCAGGCTGGGAGTGGAGAAGG + Intronic
1122629092 14:103099247-103099269 CTTTAGGTTGGGAGAGGGGAGGG - Intergenic
1122746383 14:103899484-103899506 CTCCGGGTGGGGTGGGGAGATGG + Intergenic
1122749738 14:103923929-103923951 AGGGAGGGGGGGAGGGGAGAGGG + Intronic
1123054405 14:105562257-105562279 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123078989 14:105682676-105682698 CAGCAGGAGGGGATGGGAGACGG + Intergenic
1123103235 14:105819651-105819673 CCGTGGGTGGGGAGGGCAAATGG + Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123922141 15:25077690-25077712 CTGGTGGTGGGAAGGGGAGAGGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124168103 15:27347406-27347428 CTGTAGCTGGGAAAGGGAAAAGG - Intronic
1124877926 15:33613082-33613104 CGGGAGGTGGGGAGGTGTGATGG - Intronic
1124953658 15:34345834-34345856 CTGCTGTGGGGGAGGGGAGAGGG - Intronic
1124970074 15:34479972-34479994 GGGTTGGTGGGGAGGGGAGAGGG - Intergenic
1125176026 15:36822733-36822755 TTGGAGGTGGGGAGTAGAGAGGG - Intergenic
1126002791 15:44227372-44227394 CTGTCGGTGGGGTGGGGAGCTGG + Intergenic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126865030 15:52927054-52927076 GTGGAGGTTGGGAGGAGAGAGGG - Intergenic
1127051326 15:55087308-55087330 CTGTCAGTGGGGGGCGGAGAAGG - Intergenic
1127133228 15:55890353-55890375 CTGAAGGAGGGGTGGGGAAATGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128758660 15:70199883-70199905 GGGAAAGTGGGGAGGGGAGAGGG - Intergenic
1129034866 15:72642804-72642826 ATGGAAGTGGAGAGGGGAGACGG - Intergenic
1129215016 15:74094412-74094434 ATGGAAGTGGAGAGGGGAGACGG + Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129455907 15:75676124-75676146 CTGGAGGTGGGCAGGCCAGAGGG - Exonic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1129960018 15:79675698-79675720 CTGAAGTTGGGCAGGAGAGAAGG - Intergenic
1130130906 15:81142066-81142088 ACGTGGGTGGGGAAGGGAGATGG - Intronic
1130990936 15:88875232-88875254 GCGGGGGTGGGGAGGGGAGAAGG - Exonic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131828503 15:96339446-96339468 GTAAAGGGGGGGAGGGGAGAGGG - Exonic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132056549 15:98654963-98654985 CTTTAAGTGGGGATGGGGGAGGG + Intronic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132573944 16:656279-656301 CTGTGGGTGGGGTGGGGTCAGGG - Intronic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133489009 16:6249100-6249122 AGGTTGGTGGGGAGGGGAGTGGG - Intronic
1133804702 16:9115962-9115984 ATGGAAGTGGGGAGGGGAGAGGG - Intronic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134025482 16:10949777-10949799 GTGTTGGTGGGGCGGGGAGCAGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134299351 16:12975727-12975749 TTGTAGGTGGGGCTGGGAGGGGG + Intronic
1134449511 16:14354475-14354497 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449521 16:14354497-14354519 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449536 16:14354536-14354558 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134925280 16:18153726-18153748 CTGTTGGTGGGGTGGGGGGCTGG + Intergenic
1135388279 16:22064816-22064838 CTGGAGGTGACGTGGGGAGAGGG - Intronic
1135772713 16:25229322-25229344 CTCTAGGTGGGGAGGTGGGGGGG + Intergenic
1135850740 16:25960899-25960921 CTGGAGGTAGGAAGGTGAGAAGG + Intronic
1135869972 16:26140697-26140719 CTGTCTTTGGGTAGGGGAGAAGG - Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136317915 16:29465083-29465105 CCATATCTGGGGAGGGGAGAAGG + Exonic
1136432490 16:30204432-30204454 CCATATCTGGGGAGGGGAGAAGG + Exonic
1136477731 16:30524111-30524133 AGGTAGGTGGGGTGGGGAGTGGG - Exonic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136544461 16:30947770-30947792 CTGGAGGTGGGGATGAGAGCAGG + Exonic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1137411099 16:48229021-48229043 CTTTTGGGGGGTAGGGGAGAGGG + Intronic
1138008649 16:53358803-53358825 GTGCAGGTGGGGAGAGCAGAAGG + Intergenic
1138134936 16:54513276-54513298 TGGTAGGTGGGGAAGGCAGATGG - Intergenic
1138335907 16:56252744-56252766 AGGAAGGTTGGGAGGGGAGAAGG - Intronic
1138459136 16:57137813-57137835 CTGCAGCTGGGGGCGGGAGAAGG - Intronic
1138489846 16:57370399-57370421 CTGGACCTGGGGAGGGTAGAGGG + Intergenic
1139354325 16:66358328-66358350 TTGGATGTGGGGAGGGGAGCTGG + Intergenic
1139366113 16:66434460-66434482 CTGGAGTGGGGGAAGGGAGAAGG + Intronic
1139420720 16:66848052-66848074 GTATTTGTGGGGAGGGGAGAAGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140012958 16:71154558-71154580 CTGGAGGTGGGAAGGGTAGTGGG - Intronic
1141266991 16:82506674-82506696 CTGGAGATGGGGAGGGGCGAAGG - Intergenic
1141665090 16:85461857-85461879 CAGGAGCTGGGGAGGGGTGAGGG - Intergenic
1141708375 16:85682741-85682763 CTGTAGAGGGGGAGGGCTGAGGG - Intronic
1141768818 16:86076255-86076277 CCCTTGGTGGGGATGGGAGAAGG + Intergenic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142492055 17:285783-285805 CTGTAGGGGAGCAGGGGAGCAGG - Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1143092236 17:4455706-4455728 CTGTGGGTGGGGATGCCAGATGG - Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143249848 17:5515110-5515132 CTGAAGGTGGGGATTGGAGGTGG - Intronic
1143550885 17:7629883-7629905 CTAGAGGAGGAGAGGGGAGATGG + Intronic
1143758026 17:9080681-9080703 CCGGAGGTGGGGCAGGGAGAGGG - Intronic
1143854285 17:9837232-9837254 GTGGAGGTGGGGAGGGATGATGG - Intronic
1144032721 17:11336636-11336658 CTGTTAGAGGGGAGGAGAGAAGG - Intronic
1144164906 17:12601213-12601235 GTGGGGGTGGGGCGGGGAGAGGG - Intergenic
1144206431 17:12982895-12982917 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144737041 17:17561034-17561056 CTGGAGGAAGGGAGGAGAGAGGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144930888 17:18858103-18858125 CGGTGGGCGGGGAGGGGCGAGGG - Exonic
1145104120 17:20100812-20100834 CTGTTGGTGGGTAGGGGGCAAGG - Intronic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145252276 17:21303160-21303182 CTGGCGGTGGGGTGGGGAGGAGG - Intronic
1145784673 17:27586211-27586233 CTGGAGGTGGGGGTGGGAAAGGG - Intronic
1145912789 17:28552290-28552312 CCGCGGGTGGGAAGGGGAGAGGG - Intronic
1145986262 17:29048942-29048964 CTGAAGCTTGGGATGGGAGATGG + Intronic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146502590 17:33377053-33377075 TTGGAGGGGGGGAGCGGAGATGG + Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146790414 17:35747717-35747739 CGGTAGGTGGGGAGGTGTGGGGG - Intronic
1147047406 17:37763719-37763741 CTGTCGGTGGGTAGGGGGCAAGG - Intergenic
1147164495 17:38586209-38586231 CCCTTGGTGGGGAGGGGAGCTGG - Intronic
1147325534 17:39667863-39667885 CTGGAGGAGGGGCGGGGAGGGGG + Intergenic
1147427533 17:40353147-40353169 TTGTAGAGGGGGAGGTGAGAGGG + Intronic
1147611988 17:41807240-41807262 ATGAAGGTAGGGAGGGGAGCAGG + Intronic
1147977839 17:44258218-44258240 CTGGAGGAGGTGAGGGGAAAGGG + Intronic
1148211670 17:45812623-45812645 CCCTAGCTGGGAAGGGGAGAAGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1148863271 17:50615532-50615554 CTGGAGGTGGGGGGGCCAGATGG - Intronic
1148936391 17:51166968-51166990 CTGCAGCGGGGAAGGGGAGACGG - Intronic
1148982748 17:51593008-51593030 TTGATGATGGGGAGGGGAGAAGG + Intergenic
1149168787 17:53784764-53784786 CTGTCGGTGGGTAGGGGGCAGGG + Intergenic
1149349774 17:55774869-55774891 CAGGAGGTGGGGCGGGGGGAGGG + Intronic
1149435882 17:56632904-56632926 GTGTATGTGGGGAGGGGGCAGGG - Intergenic
1149537238 17:57442532-57442554 CGGGAGAAGGGGAGGGGAGATGG - Intronic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150291217 17:63983456-63983478 CTGTGGGTGGGGACGGGAAGGGG + Intergenic
1150370251 17:64631252-64631274 ATGGAGGTGGGGGGGAGAGAGGG + Intronic
1150621078 17:66808072-66808094 TTCAAGGTGGGGAGGGGAAAGGG - Exonic
1150919820 17:69470883-69470905 TGGGAGGTGGGGATGGGAGACGG - Intronic
1151138577 17:71970724-71970746 CTGTAGGCGGGGGGAAGAGATGG + Intergenic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151175223 17:72282520-72282542 CAGCAGGTGGGAAGGGGAGAGGG - Intergenic
1151240064 17:72750420-72750442 CTGGAGGTGGGGTGGGGGGTGGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151371444 17:73648651-73648673 CTGTAGGTGGGGCTGGGCCAGGG + Intergenic
1151398962 17:73843304-73843326 CGCAAGGTGGGAAGGGGAGATGG + Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151852375 17:76698480-76698502 CTGTAGTTTGGAGGGGGAGATGG - Intronic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152118060 17:78400886-78400908 CTGTGGGTGGGGTGGAGTGAGGG + Intronic
1152140851 17:78535680-78535702 AGGAAGGAGGGGAGGGGAGAGGG - Intronic
1152256751 17:79244479-79244501 CTGAAGGTGGGGAGGGTGGGTGG - Intronic
1152284549 17:79404569-79404591 CTGGATGTGGGCAGAGGAGAGGG - Intronic
1152286475 17:79415913-79415935 CTGCAGGTGAGGAGGTGGGAGGG - Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152410606 17:80120681-80120703 GAGGAGGTGAGGAGGGGAGAGGG - Intergenic
1152913118 17:83016746-83016768 ATGAAGGTGGAGAAGGGAGATGG + Intronic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153761363 18:8335239-8335261 CTGAAGGAGGGGAGAGGGGAGGG - Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1153985503 18:10347195-10347217 GTGTGGGTGGGGTGGGGAGGAGG + Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154497913 18:14975796-14975818 GTAAAGGTGGGGTGGGGAGAGGG - Intergenic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1155381050 18:25223239-25223261 ATTTACTTGGGGAGGGGAGAAGG + Intronic
1155558851 18:27052916-27052938 CTGTTGGGGGTGAGGGGAAAGGG + Intronic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1156366645 18:36434001-36434023 CTACAGGTGGGGAGCGGAGAGGG - Intronic
1156367003 18:36438638-36438660 CAATATGTGGGGAAGGGAGATGG - Intronic
1156489401 18:37487376-37487398 TTGGAGGTGGGGAAGGCAGAGGG - Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157302019 18:46485969-46485991 CTATGGGTGGGGGAGGGAGAGGG - Intronic
1157436106 18:47670727-47670749 TGGTAGGTGGGATGGGGAGAAGG - Intergenic
1157550267 18:48576357-48576379 CGGTAGCTGGGGAAGGGAGGCGG + Intronic
1158488847 18:57892199-57892221 CTGGAGGCTGGGAGGAGAGAGGG - Intergenic
1158554674 18:58465573-58465595 CAGTAGGTGGGGAAGAGAGCAGG - Intergenic
1158744572 18:60184465-60184487 TGGAAGGTGGGGAGGGGACAAGG + Intergenic
1158829333 18:61260373-61260395 CTGCAGGTGGAGAGCTGAGAGGG - Intergenic
1158871434 18:61692222-61692244 CAGCAGGTGGGGTGGGGAGTTGG + Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1159923034 18:74243390-74243412 CTGGAGGTGGAGAGGAGGGATGG + Intergenic
1159943429 18:74426176-74426198 CTGAGGGTGGGAAGTGGAGAGGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160511279 18:79454869-79454891 GTGAAGGTGGGGAGGGGTGTGGG - Intronic
1160657937 19:282860-282882 CTGTGGGCGGGGCGGGGACAAGG - Intronic
1160682617 19:418689-418711 TTGGAGCTGGGGAGGGGACAGGG + Intronic
1160798671 19:957106-957128 CTGTGGGTGGGGGGGGGCGCTGG + Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161208902 19:3056249-3056271 CTGGAGGTGGGGGGAGGAGGGGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161821634 19:6533774-6533796 CTGGAGGGGGAGAAGGGAGAAGG - Intronic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162323632 19:9985811-9985833 CTGGGGGTGGGGGGTGGAGATGG - Intronic
1162549744 19:11351767-11351789 TTGTAGAAGGGGAGGGGAAAAGG + Intronic
1162666907 19:12221007-12221029 CTGTTGCTGGGGGTGGGAGAGGG + Intergenic
1162725210 19:12686160-12686182 GTGTAGCTGGAGAGGAGAGAGGG - Intergenic
1162818240 19:13208695-13208717 CGGGAGGCGGGGAGGAGAGAAGG - Intronic
1162855596 19:13465999-13466021 AAGGTGGTGGGGAGGGGAGAAGG + Intronic
1162911501 19:13850337-13850359 ATGAAGGTGGGGAGGGCTGAGGG - Intergenic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163041639 19:14607149-14607171 CTGACCATGGGGAGGGGAGAAGG + Intronic
1163156830 19:15444245-15444267 GTGGAGGTAGGGTGGGGAGAGGG + Intronic
1163177960 19:15577615-15577637 CTTCAGGTGGGAAAGGGAGAAGG + Intergenic
1163187978 19:15653005-15653027 CCCCAGGTAGGGAGGGGAGAAGG + Intronic
1163198830 19:15747312-15747334 CTGTTGGTGGGTGGGGGAAAGGG - Intergenic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1163284093 19:16335514-16335536 GCCTAGGTGGGGAGGGGAGCTGG - Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163566132 19:18052283-18052305 CGGGAGGTGGGGAGGGGAGGAGG + Intergenic
1163748553 19:19062152-19062174 CTGGAAGTGAGGTGGGGAGATGG + Intergenic
1163836809 19:19579937-19579959 CTGTGGATGGTGGGGGGAGATGG - Intronic
1164423236 19:28116343-28116365 GGGGAGGGGGGGAGGGGAGATGG - Intergenic
1164772938 19:30826102-30826124 CTGTAAGTGAGAAGGGTAGAGGG + Intergenic
1164999702 19:32751098-32751120 CGGGGGGTGGGGAGGGGGGAGGG - Intronic
1165112577 19:33510961-33510983 CTGGGGGTGGGTAGGGGAGGTGG - Intronic
1165186911 19:34030626-34030648 ATGGGGGTGGGGAGTGGAGAGGG + Intergenic
1165243728 19:34486002-34486024 CGGAACTTGGGGAGGGGAGAGGG - Intronic
1165320003 19:35079437-35079459 GTGAAGGTGGGGAGGAGAGGAGG - Intergenic
1165799958 19:38543430-38543452 CTGCAGGTGAGGACGTGAGACGG + Exonic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166714532 19:44958267-44958289 CTGGAGCGGGTGAGGGGAGAGGG + Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167382443 19:49146350-49146372 TTGGCGGTGGGGAGGGTAGAGGG + Intronic
1167763965 19:51468164-51468186 TTGGAGGTGGGGAGGAGATAAGG + Intergenic
1167793551 19:51694747-51694769 CTGAAGGTGGTGAGGGGGAAGGG + Intergenic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168412244 19:56147224-56147246 CTGCAAGCGGGGAAGGGAGAGGG + Intronic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
1168701774 19:58444259-58444281 CTGGAGGGGAGGACGGGAGAAGG - Intergenic
1202714294 1_KI270714v1_random:33765-33787 CGGGCGGTGCGGAGGGGAGACGG - Intergenic
925180296 2:1813171-1813193 CTGCAGGTGGGGGGGAGAGAGGG + Intronic
926205719 2:10833291-10833313 CCGGAGGAGGGGAGAGGAGAGGG - Intronic
926251179 2:11156270-11156292 CTGCAGTTGGGAAGGGGTGACGG + Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
926809897 2:16746659-16746681 AGGGAGGTGGGGAGGGAAGACGG - Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927214010 2:20656005-20656027 CAGGAGGTGGGAAGGGGAGAAGG + Intergenic
927471932 2:23384065-23384087 CTGTAGGTAGTGTGGGGAGCTGG - Intergenic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
927721774 2:25387721-25387743 CTGGAGGTGAGAAGGGGAGGTGG - Intronic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927904342 2:26846741-26846763 CGGGAGTTGGGAAGGGGAGAAGG + Intergenic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928121391 2:28586305-28586327 CTATAGGAGCGGAGGGCAGAGGG - Intronic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928404649 2:31005272-31005294 GTGGGGGTGGGGAGTGGAGATGG + Intronic
929245059 2:39692625-39692647 CTATAAAGGGGGAGGGGAGAGGG + Intronic
929905176 2:46039546-46039568 TAGTAGAGGGGGAGGGGAGAGGG + Intronic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930534554 2:52630139-52630161 CTGGGGGTGGGGCGGGGACAGGG - Intergenic
930842651 2:55864662-55864684 ATGAGGGTGGGGAGGGGTGAGGG + Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931287260 2:60843023-60843045 CTCTAGGTGGTGGGGGGACAGGG - Intergenic
931414520 2:62068233-62068255 CTGTATGTGTTGAGGGGAGCAGG + Intronic
931486838 2:62702463-62702485 CTGTTGGTTGGTAGGGGAAATGG + Intronic
931924023 2:67051673-67051695 ATGAAGGGAGGGAGGGGAGAAGG - Intergenic
932421772 2:71605522-71605544 GGGGAGGTGGGGAGGGGAGGGGG + Intronic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934893365 2:98089509-98089531 GTGGGGGTGGGGTGGGGAGAAGG + Intronic
934942931 2:98515463-98515485 CGGTGGGTGGGGCAGGGAGAGGG + Intronic
935531194 2:104234437-104234459 GTGGAGGTGGGGAAGGGAAACGG + Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935684422 2:105670970-105670992 CTCCTGGTGGGGAGTGGAGAGGG - Intergenic
935835966 2:107053660-107053682 CTGTAGGGGGGGTGGGGGCAAGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935983455 2:108649812-108649834 CTGTCGGTGGGTGGGGGATAGGG + Intronic
935998343 2:108798798-108798820 GTGTAGGTGTGGAGAGGAGGAGG - Intronic
936820994 2:116520970-116520992 CCGTTGGTGGGCAGGGGAGGTGG - Intergenic
937033450 2:118761070-118761092 CAGAAGCTGGGGAGGGGAGTTGG + Intergenic
937106943 2:119324717-119324739 CTGCAGGAGGGGAGTCGAGAGGG - Intronic
937378561 2:121354958-121354980 CAGGAGATGGGGAGGAGAGAAGG - Intronic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
937856024 2:126672536-126672558 CTGCAGGTGCTGAGGGGACAGGG - Intronic
937927229 2:127176637-127176659 GTGTAGATGGGGAGGAGGGAGGG + Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938081981 2:128374933-128374955 GGGTAGGTGGGTGGGGGAGAGGG + Intergenic
938184546 2:129218141-129218163 CTGTAGGGGGGTGGGGGAAAAGG + Intergenic
938253263 2:129833031-129833053 CTGTGGGGGGGGGGGGGAGGAGG - Intergenic
938520257 2:132063021-132063043 CTGTTGGTGGTGGGGGGAGGGGG - Intergenic
939052520 2:137325134-137325156 ATGTAGGTGGAGAAGGGAGCTGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940006884 2:149016375-149016397 CTGTAGGTGGCCATGGGGGAGGG + Intronic
940703546 2:157076099-157076121 CTGGAGGTGGGGAAGGGTGCTGG - Intergenic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
941080880 2:161059275-161059297 CTGGAGGTTGGGATGGTAGATGG - Intergenic
941684082 2:168429884-168429906 TTGTAGGTAGGGATAGGAGAAGG - Intergenic
941707666 2:168677166-168677188 CTGTTGGGGGGTGGGGGAGAAGG - Intronic
941725799 2:168858781-168858803 CTGGAGGTGTGGGGGAGAGAGGG + Intronic
941766920 2:169308369-169308391 CTGTCGTGGGGTAGGGGAGAGGG - Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941901121 2:170679506-170679528 CTGTGGGTGGGGCGGGGCGGGGG - Intergenic
942111900 2:172690845-172690867 CTGTTGGGGGGGTGGGGAGCTGG + Intergenic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
942695508 2:178638699-178638721 GTGGTGGTGGGGTGGGGAGAAGG - Intronic
942772959 2:179545014-179545036 CTGTAGGTTTGGGAGGGAGATGG - Intronic
942970387 2:181951081-181951103 CTGAAGGTGGGGTGGGGATGTGG - Intergenic
943227062 2:185191323-185191345 CTGTCGGTGGGTGGGGGACAAGG - Intergenic
943444492 2:187967303-187967325 CAGTAGATGGTGAGGTGAGAGGG - Intergenic
943451129 2:188043730-188043752 CTGTTGGGGGTGAGGGGTGAGGG + Intergenic
943792920 2:191955124-191955146 CTCTAGGTGGGGGGCGGGGAGGG + Intronic
944103491 2:196054586-196054608 GTGGAGGTGGGGTGGGGTGAGGG - Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
945769402 2:214021943-214021965 CTTTAGGTGATGAGGGGAAAAGG - Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946396521 2:219446135-219446157 CTAGCGGTGGGCAGGGGAGAGGG + Intronic
946431961 2:219630919-219630941 GTGTGGGTGGGGTGGGGGGAAGG + Intronic
946651283 2:221894524-221894546 CAGTAGATTGGGAGGGGAGAGGG - Intergenic
946711616 2:222512384-222512406 GTGTATGTGGCGTGGGGAGAAGG - Intronic
947242833 2:228015067-228015089 CTGTTGTGGGGGAGGGGGGAGGG - Intronic
947444935 2:230156392-230156414 GTCCAGGTGAGGAGGGGAGATGG - Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
948024411 2:234765383-234765405 CTGTAGGGTGTGAGGGGAGGAGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948242576 2:236449783-236449805 CACTAGCTGGGGAGGGGAGGTGG - Intronic
948295138 2:236855170-236855192 CAGGAGGTGGGGGTGGGAGAAGG - Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948444131 2:238019076-238019098 CTAGTAGTGGGGAGGGGAGAGGG - Intronic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
1168803833 20:661648-661670 CTGGAGGTGGGGAAGGGATGGGG + Exonic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170837260 20:19895051-19895073 CTGATGGTGGGGAGGGGTAAGGG - Intronic
1172014178 20:31863181-31863203 CTATAGGTGGGGTGGGGTTAGGG + Intronic
1172447300 20:34999917-34999939 CGGGAGGTGGGGACGGGAGAAGG - Intronic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172641650 20:36443736-36443758 CTGTCGGTGGGGAGGCCAGCTGG - Intronic
1173072151 20:39778836-39778858 CTGTAAGTGGAGAGGAGAGCTGG - Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173278966 20:41610296-41610318 AAGTAGATGGGGAGAGGAGACGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173811313 20:45957547-45957569 CGGTAGCTGGGAAGGGGAGCAGG + Intronic
1173869594 20:46332944-46332966 CTGGAAGAGGGGAGGGGAGGGGG + Intergenic
1173962592 20:47086598-47086620 CGGTACCCGGGGAGGGGAGATGG + Intronic
1174054882 20:47791655-47791677 GTGTGGGTGGGGAGTGGGGAGGG - Intergenic
1174107482 20:48172800-48172822 CTCTAGCTGGGGAGGGGTGATGG + Intergenic
1174216681 20:48921557-48921579 GAGAAGGTGGGGAGGGGAGTGGG - Intergenic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175039812 20:56038220-56038242 CTGAAGGTGGGGAGTGGAAAAGG + Intergenic
1175351061 20:58318635-58318657 CAGGAGGCGGGGAGGAGAGAGGG - Intronic
1176020840 20:62961625-62961647 CTGTAGGTGGGGCCGGGAGCAGG + Intronic
1176024989 20:62981356-62981378 GGGAAGGGGGGGAGGGGAGAGGG - Intergenic
1176117609 20:63439888-63439910 CTGTAGGGGAAGAGGAGAGAGGG - Intronic
1176200026 20:63855903-63855925 GTGGAGACGGGGAGGGGAGAAGG + Intergenic
1176227163 20:64007359-64007381 GGGGAGGCGGGGAGGGGAGAGGG - Intronic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1177280177 21:18971876-18971898 GTGGAAGTGGGGAAGGGAGAAGG + Intergenic
1178384779 21:32140212-32140234 GTGGAGGTGGGAAGGGGAGCAGG + Intergenic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1178524998 21:33320247-33320269 TTTTTGGTGGGGAGGGGAGAGGG - Intergenic
1178728956 21:35081391-35081413 CTATAGATGGGGAGAAGAGAAGG - Intronic
1178806667 21:35845254-35845276 CTGCAGATGGGGAGCTGAGAGGG + Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179236342 21:39550402-39550424 CTGTCGGTGGGTAGGGGACAAGG - Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179799530 21:43804484-43804506 CAGCAGGTGTGAAGGGGAGAGGG - Exonic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180124666 21:45781527-45781549 CTGTTGGTGGGAATGGGAAATGG + Intronic
1180150394 21:45944222-45944244 GAGCAGGTGAGGAGGGGAGACGG + Intergenic
1180666733 22:17519187-17519209 CTGGTGGTGGGGAGTGGGGAGGG + Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181149045 22:20869767-20869789 CGGTTGGGGGTGAGGGGAGATGG - Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181444985 22:22963436-22963458 ATGGGGGTGGGAAGGGGAGAGGG - Intergenic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181589911 22:23877643-23877665 GTGTAGGTGGGCAGGAGAGCAGG + Intronic
1181624270 22:24112768-24112790 CTGCAGCTGGGGAAGGGAAAAGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182257258 22:29048258-29048280 TTGGAGGTGGGGAGGAGAGTAGG + Intronic
1182322434 22:29486879-29486901 CTGGATCTGGGGAGGGGATAAGG - Intronic
1182585432 22:31341994-31342016 CTGTTGGTGGCAAGGGGAGAGGG - Intronic
1182756808 22:32687023-32687045 CTATAGGAGGGGAGAGGTGATGG - Intronic
1182971283 22:34580693-34580715 CTGTAGTTGGGGAGTGGAGTAGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183013110 22:34963470-34963492 TTGGAGGTTGGGAGGGGACAGGG + Intergenic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183172222 22:36196970-36196992 CTTTAGGTGGGCAGGGGAGTGGG + Intronic
1183204311 22:36408089-36408111 GTGGAGGAGGGGAGAGGAGATGG - Intergenic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183361915 22:37387217-37387239 CTGAAGGTGGGGGTGGGAGCAGG - Intronic
1183476427 22:38038528-38038550 CGGAAGGTGGGGAGGAGCGAGGG - Intronic
1183495309 22:38139953-38139975 CAGCAGATGGGGAGGGGAGGAGG + Intronic
1183736822 22:39649015-39649037 CAGCAGGTGGGGAGCGGGGAAGG - Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183799610 22:40150930-40150952 GTGTAGGAGGGGAGGGGTAAGGG - Intronic
1184092369 22:42299412-42299434 CTAGGAGTGGGGAGGGGAGATGG - Intronic
1184094258 22:42308159-42308181 TGGTAGCTGGGGTGGGGAGAGGG + Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184760415 22:46540653-46540675 AAGTAAGTGGGGAGGGGAGAGGG + Intergenic
1184987896 22:48147858-48147880 CTGCACTTGGGCAGGGGAGAGGG - Intergenic
1185001141 22:48246746-48246768 ATGTAGGTGGGGAGTGGGAAAGG - Intergenic
1185172253 22:49301060-49301082 CTGTAGGTGGGGGGACGGGACGG - Intergenic
1185173786 22:49307715-49307737 GTGAAGATGGGGAGGGGAGGAGG + Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949434419 3:4013060-4013082 ATGGAGGTGGGGAGGGGAGGTGG + Intronic
949502005 3:4688806-4688828 CAGGAGTTGGGGAGGGGAAAAGG + Intronic
949759949 3:7459339-7459361 CAGCAGGTGGGGAGCAGAGAGGG + Intronic
949765596 3:7522480-7522502 CTGGAGGTGGGGAGGAGGGCAGG - Intronic
949919803 3:8991723-8991745 CTAGAAGTGGTGAGGGGAGAGGG + Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950123314 3:10496085-10496107 CTGGGGGTGGGATGGGGAGAAGG + Intronic
950137091 3:10589103-10589125 CTGTAGGTGGGGATGGGTCAGGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950358667 3:12434420-12434442 ATGGAGGGAGGGAGGGGAGAAGG - Intergenic
950408457 3:12819094-12819116 CTGAAGGCAGGGAGGTGAGAAGG - Intronic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
950938337 3:16866471-16866493 CTGGAGGTGGGGAGGTGGGGGGG - Intronic
951329890 3:21353961-21353983 CTGTCGGTGGGTAGGGGTAAGGG + Intergenic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952575573 3:34770111-34770133 CTGGAGGTGGGGTGGGGGTAGGG + Intergenic
953104277 3:39860702-39860724 CTGTAGTTGGGGCAGGGAGTAGG - Intronic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954466693 3:50659290-50659312 CTGGAAGTGGGCAGGGGATAGGG + Intergenic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954675006 3:52310902-52310924 ATGTGGGTGGGCAGGGGCGATGG + Intergenic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954757715 3:52850684-52850706 CTGCAGATGGGGATGGGCGAAGG - Intronic
956109413 3:65855605-65855627 CGGGAGATGGGGAGGAGAGAGGG + Intronic
956612446 3:71137869-71137891 CAGGAGGAGGGAAGGGGAGAAGG - Intronic
956659549 3:71583994-71584016 ATGTCGGGGGGGAGGGGGGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957389051 3:79537729-79537751 CTGTTGGGGGAGTGGGGAGAGGG + Intronic
958574421 3:95929610-95929632 TGGGAGGTGGGGAAGGGAGATGG - Intergenic
958578184 3:95979477-95979499 CAGAAGCTGGGTAGGGGAGATGG + Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959650043 3:108742651-108742673 CTGGAGGTGGTGAGGAGAGGAGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960317952 3:116201141-116201163 CTGAAGGTGGGATGGGGAGAAGG - Intronic
960338638 3:116447889-116447911 CTGTTGGTGGTGTGGGGAAAGGG - Intronic
960728783 3:120701025-120701047 CTATAGGGGGCCAGGGGAGATGG - Intronic
960771297 3:121195430-121195452 GTGAAGCAGGGGAGGGGAGAAGG - Intronic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961805733 3:129488001-129488023 CTGTAGGTGGGAAGGAGGGGAGG + Intronic
962250763 3:133834720-133834742 CTGCAGGTTGGGAGGGGAAGAGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962403506 3:135081092-135081114 GTGAAGGAGGGGAGGGGAGGTGG + Intronic
962696410 3:137951878-137951900 TTGTTGTTGGGGCGGGGAGAGGG - Intergenic
962806964 3:138934700-138934722 GTGTAGCTGGGGTGGTGAGAGGG - Intergenic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
963436368 3:145272659-145272681 AAGGAGGTGGGGAGGGGGGAGGG - Intergenic
963594431 3:147307497-147307519 CTGTTGGGGGGCAGGGGAGTAGG - Intergenic
963729571 3:148958309-148958331 GTGTGGCTGGGCAGGGGAGATGG - Intergenic
963774116 3:149421189-149421211 CAGTTGGTGGGGAGGAGAGGAGG + Intergenic
963783371 3:149509347-149509369 GGGAAGGTGGGCAGGGGAGAAGG - Intergenic
964205770 3:154173199-154173221 CTGCAGGTGGGGTGGGGGGGTGG - Intronic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
965602564 3:170469493-170469515 CTGTAGGTGGGGGGTGGCTATGG + Intronic
965630896 3:170731437-170731459 CAGTAGGAGGGGAGCAGAGAGGG + Intronic
965751516 3:171979436-171979458 CTGGAGGTCGGGCAGGGAGAGGG - Intergenic
966154516 3:176901574-176901596 ATGTAGGTAAGAAGGGGAGAAGG + Intergenic
966283534 3:178265135-178265157 CTGTTGGGGGGCAGGGGTGAGGG - Intergenic
966571374 3:181447459-181447481 CTCTAGGTGGAGAGAGTAGAAGG + Intergenic
966646191 3:182248443-182248465 CAGGAGCTGGGGAGGTGAGAAGG + Intergenic
967403087 3:189085213-189085235 CTATAGGTGGGGTGAGGTGAAGG + Intronic
967726172 3:192864452-192864474 CTTTAGGAGGGCAAGGGAGAAGG - Intronic
967757987 3:193191785-193191807 GTGTATGTTGGGAGGGGAGGAGG + Intergenic
967904125 3:194486848-194486870 CGGGAGGTGGGCAGGGGAGGGGG + Intronic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
967963807 3:194945018-194945040 TTGTAGCTGGGGAGGGGAATGGG + Intergenic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968234671 3:197024484-197024506 CTCTAGGAGGGGAGGGGAGTGGG + Exonic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968762482 4:2449806-2449828 GGGAAGGTGGGGTGGGGAGAGGG + Intronic
968887257 4:3341430-3341452 GGGTATGTGGGGAGGGGACAAGG + Intronic
970234292 4:13943312-13943334 GTGTAGTTGGGGAAAGGAGATGG + Intergenic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970748102 4:19324286-19324308 CTGTTGGTGGGAATGTGAGATGG - Intergenic
971176011 4:24283377-24283399 CTGAAGGTGGGTAGGGCAGGTGG - Intergenic
971310971 4:25525504-25525526 CTGGAGCTGAGGAGGAGAGAGGG - Intergenic
971511410 4:27429708-27429730 TGGGAGGTTGGGAGGGGAGAAGG + Intergenic
971893520 4:32558610-32558632 CTGTTGGGGGGTGGGGGAGAAGG + Intergenic
973643046 4:52922058-52922080 CAGGAGGTAGGGAGGTGAGACGG - Intronic
973663262 4:53130575-53130597 GTGTAGAGGGAGAGGGGAGATGG - Intronic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
974036400 4:56821788-56821810 CGGTAGGTGGCGAGGGAAGAGGG + Intergenic
974629134 4:64460572-64460594 CTGTAGGAGGGGAGGGGTGGGGG - Intergenic
975281472 4:72568044-72568066 GTGCAGAGGGGGAGGGGAGAAGG + Intronic
975630969 4:76401887-76401909 GTGGAGGTGGGCAGGGGAGATGG + Intronic
975686818 4:76924397-76924419 CCATATCTGGGGAGGGGAGAGGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
976973393 4:91136483-91136505 TTGTAGGTCAGGATGGGAGATGG - Intronic
977987565 4:103401854-103401876 GTGTAGGTGGGGTGGGGTGGGGG + Intergenic
978036830 4:104005132-104005154 CTGGAGGTGGGTAGGAGAAATGG + Intergenic
978047331 4:104146817-104146839 CTGGAGGTGGGGCGGGTACATGG - Intergenic
978268986 4:106865121-106865143 CTGTTGGTGGGTAGGGGTCATGG - Intergenic
978413107 4:108446761-108446783 TGGTAGGTGGGGAGGGGAGCAGG - Intergenic
978710576 4:111775638-111775660 CTTCAGGAGGGGAGGGGAGGAGG + Intergenic
979858543 4:125664813-125664835 CTGTCAGTGGGAAGGGGAGCTGG + Intergenic
979942892 4:126784913-126784935 CTGTAGTTGGAGAAGGGAGGAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980054085 4:128062764-128062786 CTTTATGGGGGGAGGGGGGAGGG + Intronic
980285940 4:130778502-130778524 CTGTTGGAGGGTAGGGGAGTAGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
981315407 4:143336244-143336266 CTGAACGTGGGAAGGGGAGGAGG + Intergenic
981494582 4:145377054-145377076 CTTGAGGCGGGCAGGGGAGAGGG - Intergenic
982091673 4:151884877-151884899 CTGGAGGTGGGGGTGGTAGAGGG + Intergenic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982741437 4:159061299-159061321 CTGAAGGTGATGAGGGGACAGGG - Intergenic
982745386 4:159100978-159101000 GTGCAAGTGGGGTGGGGAGAGGG + Intergenic
982903033 4:161030817-161030839 CTGTTGTGGGGTAGGGGAGAGGG + Intergenic
983183174 4:164672092-164672114 CTGTTGTGGGGTAGGGGAGAGGG + Intergenic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703344 4:182832391-182832413 CAGAAGGAGGGGAGAGGAGAAGG - Intergenic
984703739 4:182833877-182833899 AAGGAGGAGGGGAGGGGAGAAGG - Intergenic
984779748 4:183514389-183514411 AAGTAGATGGGGAGGAGAGAGGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985393360 4:189514913-189514935 CTGCAGGAGGGGGGGGGGGATGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985629911 5:1008927-1008949 CGGTAGGAGGTGAGGGAAGATGG - Exonic
985675639 5:1230041-1230063 CTGGAGGTGGGGGAGGGAAAAGG + Intronic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986371795 5:7087655-7087677 CAGTTGGTGGAAAGGGGAGATGG + Intergenic
986373440 5:7105231-7105253 GTGGAGGTGGGGAGGGGGAATGG + Intergenic
986799731 5:11246713-11246735 CTGTAGGTGGGTGGGGGGGTGGG + Intronic
987044682 5:14096068-14096090 TTGAAGATGGGGAGAGGAGAAGG + Intergenic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987626413 5:20406427-20406449 CTGTTGTGGGGGAGGGGGGAGGG + Intronic
987627981 5:20428092-20428114 CTGTTGGTGGGTGGGGGAAAAGG - Intronic
988192432 5:27956260-27956282 TGGCATGTGGGGAGGGGAGACGG + Intergenic
988222132 5:28361149-28361171 CTGGAGATGGGGAGTGGCGATGG + Intergenic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988392486 5:30653725-30653747 ATTTAGGTGGGATGGGGAGAGGG - Intergenic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
990416995 5:55596311-55596333 CTGCATGTGGGGAGGAAAGATGG + Intergenic
990884990 5:60581035-60581057 GTGTAGCAGGGGATGGGAGAAGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991550960 5:67835407-67835429 CTTGAGGAGGGGATGGGAGAAGG - Intergenic
991718217 5:69471873-69471895 CTGTAGGGGGGTGGGGGAGAAGG + Intergenic
992000652 5:72432679-72432701 CTGGAGCTGGGGAGGGGGAAGGG + Intergenic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
992176559 5:74154945-74154967 CTGTAGGTGGGGAGCAAAGAGGG + Intergenic
992624685 5:78626494-78626516 CTGGGGGTGGGGCGTGGAGAGGG - Intronic
992894388 5:81233975-81233997 AGGATGGTGGGGAGGGGAGACGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993204830 5:84865113-84865135 CTGGTGATGGAGAGGGGAGAGGG - Intergenic
993621768 5:90177097-90177119 TTTTTGGTGGGGAGGGGAGATGG - Intergenic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993901057 5:93584618-93584640 CGGGGGGTGGGGAGGGGGGAAGG + Exonic
994576858 5:101589304-101589326 CTGTTGTTGGGGTGGGGAGGGGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994691803 5:103028783-103028805 CAGAAGGTGGGGATGGGAAAGGG - Intronic
995814911 5:116157349-116157371 CTGTAGGTGGGCAAGGCAGTTGG + Intronic
996204469 5:120714982-120715004 CTGTTGGTGGTGGGGGGTGAGGG + Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997321816 5:132983941-132983963 CCGTGGGGGGGGGGGGGAGAGGG + Intergenic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997767590 5:136520388-136520410 ATTCAGGTGGGGAGGAGAGAAGG + Intergenic
998099441 5:139419749-139419771 CAGCTGGTGGGGAGAGGAGAGGG + Intronic
998461826 5:142315156-142315178 CTGGGGGTGGGGTGGGGAAAAGG + Intronic
998584457 5:143412260-143412282 GTGCAGGGGGGGAGGGGGGAGGG + Intronic
998590902 5:143477113-143477135 CTGTAAATGGGAAGAGGAGAGGG - Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
1000019142 5:157303814-157303836 CTGGCGGTGGGGAGGGGGGCAGG - Intronic
1000185460 5:158853551-158853573 TCATAGGTGGGGAGGAGAGAAGG + Intronic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1001907847 5:175487819-175487841 CTGGAGGTGGAGAGGGCCGAGGG - Intronic
1001995895 5:176157784-176157806 ATGGATGTGGGGCGGGGAGATGG - Intergenic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002100519 5:176855401-176855423 CCATTGGTGGGGATGGGAGAGGG + Intronic
1002327653 5:178420442-178420464 ATAGAGGTGGGGAGGGGAGGAGG - Intronic
1002471507 5:179438602-179438624 CTGTAGTTGAGGACTGGAGAGGG - Intergenic
1002887454 6:1310168-1310190 CTGCAGCTGGGGAGGGGAGGAGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003428679 6:6018873-6018895 CTGAAGGGGGTGAGGGGAAAAGG - Intergenic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1003564931 6:7214805-7214827 GTGTTGGTGGGGAGTGGAGAAGG - Intronic
1003674744 6:8192797-8192819 GAGAAGGTGGGGAGGAGAGATGG + Intergenic
1003815525 6:9836125-9836147 CTGTCGGGGGTGCGGGGAGAGGG - Intronic
1004190634 6:13460659-13460681 CTGTTGGGGGTGTGGGGAGAGGG + Intronic
1004348494 6:14869972-14869994 CTGGAGCTTGGGAGAGGAGAGGG - Intergenic
1004487380 6:16079494-16079516 AGGGAGGTGGGGAGGGGAGCAGG + Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1004947041 6:20626968-20626990 CTGTAGACGGGGAAGGGAGAAGG + Intronic
1005342673 6:24858054-24858076 CTCTAGTTGGGGAGAGGAGCAGG - Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006052209 6:31353823-31353845 TTGCAGGTGGGGTGTGGAGAAGG - Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006319675 6:33313196-33313218 AGGTAGCTGGGGAGGGGAGGTGG - Exonic
1006472125 6:34235364-34235386 CTGGACGTGGGGCGGGGAGCCGG + Intergenic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1006820599 6:36891140-36891162 CTGTAGTGGGGTAGGGGAGTGGG - Intronic
1006923890 6:37643748-37643770 CTGGAGGATGGGAGGGGAGTGGG - Intronic
1007382183 6:41497567-41497589 CTGCAGTTGGGGCGTGGAGAGGG - Intergenic
1007406763 6:41639897-41639919 AAGTAGGTGGGGAGTGGAGAGGG - Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007693919 6:43719713-43719735 CTGGCAGTGGGGCGGGGAGAGGG + Intergenic
1007765818 6:44159160-44159182 TTGGAGTTGGGGAGAGGAGAGGG + Intronic
1008193088 6:48483868-48483890 CTGGTGGTGGGTAGGTGAGAGGG + Intergenic
1008551836 6:52639984-52640006 AGGTAGGTGGGGATGGGTGAGGG + Intergenic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010852720 6:80797520-80797542 CTGTTGTTGGGGAGGTGAGCAGG + Intergenic
1011275260 6:85625119-85625141 CTGGAGATGGGGAAGGGACAGGG - Intronic
1011421844 6:87181288-87181310 CAGAAGGTGGGGAGGGGTGGGGG + Intronic
1011833329 6:91401072-91401094 CTGTTGTGGGAGAGGGGAGAGGG - Intergenic
1012300494 6:97581599-97581621 CTGTCGGGGGGAAGGGGAGCTGG + Intergenic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013167142 6:107604601-107604623 AAGGAGGTGGGGAGGGGAGATGG - Intronic
1013177688 6:107691297-107691319 GTGGAGGCGGGGAGGGGGGAGGG - Intergenic
1013278468 6:108610089-108610111 CTGTATATGGGGAGGGGAAGGGG - Intronic
1013366601 6:109442091-109442113 CTGGAGGTGGGGAAGGGAGGTGG - Intronic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013535665 6:111061045-111061067 GTGCATGTGGGGAGGGGAGGGGG - Intergenic
1013586938 6:111587626-111587648 ATCTTGGTGGGGAGGGGAGCAGG - Intronic
1013787771 6:113800904-113800926 GTGTAGGTGGAGAAGGGGGACGG + Intergenic
1013911274 6:115278778-115278800 CAGCTTGTGGGGAGGGGAGAAGG + Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1014707035 6:124760346-124760368 GTGTAGGTGGGGCGGGGGGCGGG - Intronic
1014847545 6:126296980-126297002 CTGTTGTAGGTGAGGGGAGAAGG - Intergenic
1015356870 6:132287607-132287629 GTGTATGGGGGTAGGGGAGAGGG + Intergenic
1015594086 6:134849624-134849646 TTGTTGGGGGGGAGGGGGGAGGG + Intergenic
1015958265 6:138620946-138620968 CTGCAGCTGGGGAGGACAGATGG + Intronic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016337981 6:143029389-143029411 CTGTAGGTGGGTGGGGGACTGGG - Intergenic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1017047419 6:150360235-150360257 CTGTCGGTGGGTGGGGGACAAGG - Intergenic
1017055812 6:150434721-150434743 ATGGAGGTGGGGAGGGAAGGGGG - Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017711296 6:157170618-157170640 CTGTAGGTGGCTGGGGGAGCTGG + Intronic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1017981520 6:159404486-159404508 GTGGAGGTGGGGATGGGGGATGG + Intergenic
1018148934 6:160920572-160920594 CCATAGCTGGGGAGGAGAGAAGG + Intergenic
1018187942 6:161283997-161284019 ATGCAGGTGGGGTGGGGAGTGGG + Intergenic
1018219836 6:161566774-161566796 CTGGTGGAGGGGAGGGGAGGAGG - Intronic
1018383855 6:163285177-163285199 TTGCAGGTGGGGTGGGGAGAGGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019693010 7:2427566-2427588 CTGTAGGGGGGGGTGGCAGATGG - Intronic
1020089736 7:5332538-5332560 CCCTAGGCTGGGAGGGGAGAGGG + Intronic
1020247113 7:6438197-6438219 CTGTAGTTGGGTGGGGGAGGAGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1020921520 7:14270828-14270850 CTGTAGGGGGGTGGGGTAGAAGG + Intronic
1022617299 7:31944427-31944449 CTGAGGGTGGGCAGGTGAGAGGG + Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023752445 7:43385294-43385316 ACGCAGGAGGGGAGGGGAGAGGG - Intronic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1024317784 7:48036976-48036998 CTGTAGGAGGGTAGAGAAGAGGG + Intronic
1025581304 7:62721828-62721850 CTGTTGGGGGGGTGGGGGGAGGG + Intergenic
1025581774 7:62728743-62728765 CTGTTGGGGGGGTGGGGGGAGGG - Intergenic
1026791361 7:73334390-73334412 AACTAGGTGGGGAGGGGGGAGGG - Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1027002437 7:74662902-74662924 GTGTAGGTGGGGAAAGGAGGGGG - Intronic
1027053802 7:75036513-75036535 CTGCAGATGGGGTGGTGAGAAGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027683166 7:81245843-81245865 CTCTAGGTGGGAAGGGAAGTGGG + Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1029529719 7:101117321-101117343 GTGTAGGAGAGGAGGGGAGCAGG - Intergenic
1029635981 7:101784040-101784062 ATGTGGGTGGGCAGGGGACAGGG + Intergenic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030829074 7:114198421-114198443 CTATAGGGGGGTAGGGGATAGGG + Intronic
1031288750 7:119906752-119906774 TAGTAGCTGGGGAGGGTAGAGGG - Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1032836886 7:135682916-135682938 CAGTAAGATGGGAGGGGAGAGGG + Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033146697 7:138877129-138877151 ATGGAGGTGGGGAGCGGGGAGGG - Intronic
1033157345 7:138968186-138968208 CGGTAGGTGGGGTGGGAGGAGGG + Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033423349 7:141221736-141221758 CTGAAGATGGGGAGGGCAGCAGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034984686 7:155501836-155501858 GTTTAGGTGGGGAGGGGGCATGG + Exonic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035379434 7:158428180-158428202 CTGTAAGAGGGCAGGGGAGCTGG + Intronic
1036188512 8:6647745-6647767 CTGCAGCTGGGGATGGGAGTGGG + Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037026271 8:14041734-14041756 CTGGCGGTGGGGTGAGGAGAGGG + Intergenic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1038662291 8:29507551-29507573 AAGCAGGTGGGGAGGAGAGAGGG + Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038772741 8:30498299-30498321 AAGCAGGTGGGGAGGGGAGTTGG + Intronic
1039129732 8:34249414-34249436 CTGGAGATGGGGTGGGGATATGG + Intergenic
1039273949 8:35914279-35914301 CTGTCGGTGGGTAGGGGGTAAGG + Intergenic
1039386755 8:37143049-37143071 GTGTAGGTGAGGCGGGGAGGAGG - Intergenic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039505711 8:38050942-38050964 CTGAAGCAGGGGAGAGGAGAGGG + Intronic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039640361 8:39213815-39213837 GGGCAGGTGGGGAGGGGACAAGG - Intronic
1039781718 8:40792709-40792731 GAGGAGGTGGGGAGGGGAGGAGG + Intronic
1040007043 8:42629497-42629519 CTGCTGGAGGGGAGGGGAGCTGG + Intergenic
1040038959 8:42897219-42897241 CGGTAGGTGGCGGGGGGAGGGGG - Intronic
1040904624 8:52453654-52453676 GTGCTGGTGGGGAGTGGAGATGG - Intronic
1040905926 8:52469890-52469912 CAGGAGGGGAGGAGGGGAGAGGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041037844 8:53813569-53813591 CTGAAGGTGGACAGGGGAGGAGG - Intronic
1041319489 8:56598729-56598751 CAGTAGGTGAGAAGAGGAGATGG - Intergenic
1041345813 8:56896766-56896788 CTGTTGGCGGGGTGGGGGGAGGG + Intergenic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042570919 8:70163734-70163756 TGGTAGGTGGGTAAGGGAGACGG + Intronic
1042868489 8:73376925-73376947 CTATAGCTGGGGAGGGGAGCTGG + Intergenic
1043144651 8:76637820-76637842 CTGTCGCGGGGGTGGGGAGATGG + Intergenic
1043402606 8:79898776-79898798 CTGTAGGTGGGTTGGGGGGTAGG + Intergenic
1043722672 8:83565584-83565606 GTGCGGGTGGTGAGGGGAGATGG - Intergenic
1044418790 8:91967374-91967396 TTGTAGGTGGGCGGGGGAGGGGG - Intronic
1044817745 8:96130523-96130545 TTGATGGTGGGGAGGGGACAGGG - Intergenic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047213656 8:122859589-122859611 TTGAAGGAGGGGAGGGGAGTGGG + Intronic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1048186104 8:132242287-132242309 ATGGAGGTGGGGTGGGTAGAAGG + Intronic
1048361626 8:133701994-133702016 GTGATGGTGGGGAGGGGGGAAGG + Intergenic
1048403747 8:134097226-134097248 GTGTATGTGGGGTGGGGAGTGGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048934982 8:139347488-139347510 CACTAGGTGGGGAAGGGAAAAGG + Intergenic
1049052021 8:140205753-140205775 CTGTAGGAGGGGTGGTGAGCGGG - Intronic
1049284224 8:141765946-141765968 CTGGACGTGTGGATGGGAGAGGG + Intergenic
1049295407 8:141831435-141831457 GGGCATGTGGGGAGGGGAGATGG - Intergenic
1049659320 8:143812668-143812690 CTGTCCCTGGGGAGGGGAGGTGG - Intronic
1049712417 8:144071268-144071290 GCGGAGGAGGGGAGGGGAGAGGG - Intergenic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1049840329 8:144766939-144766961 CTGGAGAGGGGCAGGGGAGAGGG - Intergenic
1049951355 9:647101-647123 CCATAGGTGGGGAGTGGGGAGGG + Intronic
1050062080 9:1719854-1719876 CTGGAGGTGGGGAGTGAAGGAGG + Intergenic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050219803 9:3374217-3374239 CTGTTGGTGGGGATGTGAAATGG + Intronic
1050713075 9:8487866-8487888 CTCTACGGGGGGAGGGGGGAAGG + Intronic
1050945662 9:11513512-11513534 ATGTAGGAGGGGAGGGAAAATGG + Intergenic
1052003476 9:23317496-23317518 CTGTCGGTGGGTAGGGGACTAGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052438671 9:28465013-28465035 CTGTATGTGGGGCGGGGGGGCGG - Intronic
1052861192 9:33438958-33438980 CTGGAGGTGGGGTGAGGAGGTGG + Intergenic
1053018188 9:34676000-34676022 ATGTAGGTGGGGCGGGGAAAGGG + Intergenic
1053281926 9:36826124-36826146 CTGGGGGTGGGGGGGGGAGGGGG - Intergenic
1053450743 9:38192215-38192237 AGTGAGGTGGGGAGGGGAGAGGG + Intergenic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1055365689 9:75542346-75542368 CTGGAGGTGGGGAAGAGAGAAGG + Intergenic
1055437538 9:76307578-76307600 CTGTTGGAGGGAAAGGGAGAAGG + Intronic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1055931613 9:81565123-81565145 CAGTACCTGGGGAGGGGGGAGGG + Intergenic
1056465423 9:86848920-86848942 CTGTCGGTGGTGAGGGGCTAAGG - Intergenic
1056485077 9:87047737-87047759 CTGTTGTGGGGGAGGGGGGAAGG + Intergenic
1056501823 9:87217124-87217146 ATGGAGGTTGGGAGAGGAGAGGG + Intergenic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1056551526 9:87656924-87656946 GAGTAAGGGGGGAGGGGAGAAGG + Intronic
1056734476 9:89195650-89195672 CAGAAGCTGGGAAGGGGAGAGGG + Intergenic
1056788127 9:89606882-89606904 CTGTAGGAGGGAGGGGGAGGAGG - Intergenic
1057019944 9:91689269-91689291 CTAGAGGTGGGGAGGTGAGGAGG + Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057620378 9:96629294-96629316 CTGTAGTTGTGGAAGGGTGAAGG + Intergenic
1057723785 9:97554210-97554232 AGGCAGGTGGGCAGGGGAGAGGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057797678 9:98170256-98170278 CTGTAGGTGGGCACAGCAGAAGG - Intronic
1057861032 9:98641047-98641069 CAATAGGGGTGGAGGGGAGAAGG - Intronic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058258624 9:102802225-102802247 CTGTTGGTGGGTAGGGGTTAGGG + Intergenic
1058669336 9:107347449-107347471 CTCAAAGTGGGGAGGTGAGATGG + Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059282340 9:113145676-113145698 CTGGTGGTGGGGAGGGGTCAGGG - Intergenic
1059570813 9:115433058-115433080 TTGTATGTGGGGTTGGGAGAAGG + Intergenic
1060068816 9:120528935-120528957 CTTTGGGTGGGGTGGAGAGAGGG - Intronic
1060198362 9:121637567-121637589 TTGGAGGAAGGGAGGGGAGAGGG + Intronic
1060215902 9:121738035-121738057 CTGGAGGTGGGGAGGTGGGCTGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061049364 9:128185519-128185541 TGGTAGGTGGGGATGGGAGTGGG - Intronic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061280673 9:129596440-129596462 CACTAGGTGGGCAGAGGAGAGGG + Intergenic
1061396142 9:130344147-130344169 CTGCAGGTCGGGAGGGGTGATGG - Intronic
1061471114 9:130826743-130826765 CTGTAGGTGGTTAGGAGAGGTGG - Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062485373 9:136772090-136772112 AGGTAGATGGGGAGGGGAGGTGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186239622 X:7552535-7552557 TGGGAGGAGGGGAGGGGAGAAGG - Intergenic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1187108450 X:16269843-16269865 CGGTGGGTGGGGTGGGGGGAGGG - Intergenic
1187172938 X:16869793-16869815 CTGGAGGAGGGAAGGGAAGAGGG + Exonic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187431605 X:19229909-19229931 CTGTCGATGGGGAGGGGCGCTGG - Intergenic
1187584008 X:20639794-20639816 GTGAAGGTGGGGAGGGGGGAGGG - Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188254800 X:27948744-27948766 CTGTAGGGGGGTAGGGGGCAAGG - Intergenic
1188990405 X:36812042-36812064 ATGTAGGTGTGGAGTGGAAAGGG - Intergenic
1189231760 X:39457800-39457822 CTGCTGCCGGGGAGGGGAGAAGG - Intergenic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1189861966 X:45281962-45281984 CTGTTGGGGGTGAGGGGTGAGGG - Intergenic
1189961144 X:46325896-46325918 ATGGAGGCGGGGAGGGGAGATGG + Intergenic
1190879044 X:54479670-54479692 CTGGGGGTGGGGTGGGGAAAGGG + Intronic
1191163429 X:57360823-57360845 CTGTCGGTGGGTGGGGGTGAGGG - Intronic
1191716974 X:64200424-64200446 CTGAAGCTTGGGAGGGGACAAGG + Intronic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1193086211 X:77449278-77449300 CAGTAGGTTGGGAGGGGTAATGG + Intronic
1193092512 X:77510035-77510057 CTTGAGGTGAGGAGAGGAGAGGG + Intronic
1193120360 X:77817092-77817114 AGGTAGGAGGGGAAGGGAGAAGG - Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194159321 X:90431593-90431615 CTTTTTGTGGGGAGGGGGGAGGG + Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1194803049 X:98294928-98294950 CTGTAAGTTGTGAGGGCAGAGGG + Intergenic
1194871735 X:99140980-99141002 CGATCCGTGGGGAGGGGAGAGGG - Intergenic
1195064280 X:101225680-101225702 ATTTTGGTGGGGAGCGGAGAGGG + Intronic
1195076857 X:101335651-101335673 CTGTAGTGGGGGTGAGGAGAAGG + Intergenic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1196033177 X:111113759-111113781 GGGGAAGTGGGGAGGGGAGAGGG - Intronic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1196818253 X:119682446-119682468 ATGTAATTGGGGAGGGGAGTGGG - Intronic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1196927969 X:120652630-120652652 CTGTCGGTGGGTAGGGGGCAAGG + Intergenic
1197554984 X:127942084-127942106 CTGTGGGTGGGGAGTGGTGGGGG - Intergenic
1197861407 X:130974655-130974677 GCTTAGCTGGGGAGGGGAGATGG + Intergenic
1197888367 X:131241193-131241215 CTGTTGGTGGGTGGGGGAAAGGG + Intergenic
1197946662 X:131846418-131846440 GGGCAGGTGGGGTGGGGAGAGGG + Intergenic
1198317099 X:135478855-135478877 GTGTTGATGGGGAGAGGAGAGGG + Intergenic
1198383509 X:136105700-136105722 CTTTAAGTGGAGAGGGGTGAGGG + Intergenic
1198409441 X:136350888-136350910 CTGCAGGTAGGGATTGGAGAAGG - Intronic
1198672823 X:139099674-139099696 CTGTAGCTGAGGTGGGGAGGAGG + Intronic
1198684719 X:139215709-139215731 CTGTCGGTGGTGTGGGGAAAGGG - Intronic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1199955869 X:152742021-152742043 CTGTAGGGAGTGGGGGGAGATGG - Intergenic
1200255557 X:154580693-154580715 CTGCAGGCGGGGAGGAGGGAAGG - Intergenic
1200262212 X:154623711-154623733 CTGCAGGCGGGGAGGAGGGAAGG + Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201320509 Y:12693581-12693603 CTTTCAGTGGGGAGGGGACAAGG + Intergenic
1201578037 Y:15481239-15481261 CGGTAAATGGGTAGGGGAGATGG + Intergenic
1202088443 Y:21163431-21163453 CTCTAGGTGGGGTGGGGGGCGGG - Intergenic