ID: 1076064741

View in Genome Browser
Species Human (GRCh38)
Location 10:127440296-127440318
Sequence GCGGCCAGTGGGAGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076064741_1076064752 10 Left 1076064741 10:127440296-127440318 CCCAGATGCCTCCCACTGGCCGC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1076064752 10:127440329-127440351 TTTCAACATGAGAGTTGGAGAGG 0: 9
1: 899
2: 1676
3: 2801
4: 5606
1076064741_1076064751 5 Left 1076064741 10:127440296-127440318 CCCAGATGCCTCCCACTGGCCGC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1076064751 10:127440324-127440346 CAACATTTCAACATGAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076064741 Original CRISPR GCGGCCAGTGGGAGGCATCT GGG (reversed) Intronic
900595000 1:3476619-3476641 GCGGCCAGTGTGTGGGATCGTGG - Intronic
900799046 1:4726450-4726472 GTGGGGAGTGGGAGGCTTCTGGG + Intronic
900967171 1:5966827-5966849 GCAGCCAGAGGGAGCCATTTGGG - Intronic
901447043 1:9314858-9314880 GCAGCCAGTGGGAGGCTCCAGGG + Intronic
903153551 1:21429546-21429568 GTGGCCACGGGGAGGCCTCTTGG + Intergenic
903238077 1:21963689-21963711 GGCAGCAGTGGGAGGCATCTGGG + Intergenic
903971937 1:27124645-27124667 GCAGCCTCTGGGAGGCAACTGGG + Intronic
907429918 1:54405879-54405901 GCGGGCGGTGGGAGGCAGGTGGG - Intronic
909564421 1:77039113-77039135 GGAGCCAGTGGGAGGCAGGTGGG - Intronic
909675793 1:78237671-78237693 AAGGCCAGAGGGAGGAATCTGGG + Intergenic
910013236 1:82491045-82491067 TTGGCCAGTGAGAGGCATTTTGG - Intergenic
910448419 1:87322535-87322557 GAGGACAGAGAGAGGCATCTGGG + Intergenic
912677699 1:111700513-111700535 GAGGCCTGTGGGAGGTATTTGGG - Intronic
914884332 1:151572949-151572971 GCAGTCAGTGTGAGGCACCTGGG + Intronic
915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG + Exonic
916026645 1:160838853-160838875 GCGTCCAGTGGGATGTGTCTGGG - Intronic
916182222 1:162095230-162095252 GGGGCCTTTGGGAGGCAACTAGG + Intronic
916247055 1:162698715-162698737 CTGGCCAGTGGGAGGCTTGTAGG + Intronic
916899679 1:169207320-169207342 GGGCCTAGTGGGAGGCATTTGGG - Intronic
917351039 1:174077978-174078000 GTGGCCAATGGGAAGCTTCTAGG + Intergenic
920831149 1:209466943-209466965 GGGCCCAGTGGGAGGTATTTGGG - Intergenic
922534820 1:226372043-226372065 GCAGCCAGGAGGAGGCTTCTAGG + Intronic
922812711 1:228426713-228426735 GGGGCCAGTGGGAGGTGTGTGGG + Intergenic
923512606 1:234665379-234665401 GGGGACAGTGGTAGGCATATGGG - Intergenic
1065845493 10:29739464-29739486 GAGGCCTCTGGGAGGCATCAGGG - Intergenic
1067433817 10:46263790-46263812 GGGTCCAGGGGGAGGCAGCTGGG + Intergenic
1067591785 10:47519072-47519094 GGGCCTAGTGGGAGGCATTTGGG + Intronic
1068688006 10:59889122-59889144 GTAGCCAGTGGGGAGCATCTTGG - Intronic
1070654745 10:78263605-78263627 GAGGCCCATGGAAGGCATCTGGG + Intergenic
1070689435 10:78513683-78513705 GTGGACAGTGGGAGGTGTCTAGG + Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074782015 10:116808949-116808971 GCGGGGAGTGGGAGGCAAGTCGG + Intergenic
1075478442 10:122756930-122756952 GTGGGCAGTGAGAGCCATCTGGG + Intergenic
1076024269 10:127099719-127099741 GGGGACAGTGGGAGGTGTCTGGG - Intronic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1082936426 11:58661490-58661512 GTGGCCAATGGGAGACCTCTAGG - Intronic
1084170117 11:67396942-67396964 GGGGCCTGAGGGAGGCATCCCGG - Intronic
1084569102 11:69948996-69949018 GCTGCCAGTGGGGGGGCTCTGGG - Intergenic
1089425532 11:118370958-118370980 GGGGCTAGTGGGAGGTGTCTGGG - Intronic
1091615383 12:2047088-2047110 GCGGCCAGTGCACGGCCTCTGGG + Intronic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1103321733 12:120096184-120096206 ACCTCCAGTGGGAGGCAACTCGG + Exonic
1103394942 12:120600245-120600267 GCAGCCAGAGGGAGCCATCAAGG - Intergenic
1103911778 12:124355940-124355962 GAGGACAGTGGGAGCCATCGAGG - Intronic
1104944472 12:132409510-132409532 GCAGCCTGTGGGGGGCTTCTGGG + Intergenic
1108433356 13:50377104-50377126 GAGGCCACTGGGAGGCAGCAGGG + Intronic
1109306541 13:60647781-60647803 GCTGACAGTGGGAGGCTTCTGGG + Intergenic
1109944458 13:69414825-69414847 GAAGACAGTGGGAGTCATCTGGG + Intergenic
1112004924 13:95245789-95245811 GTGGGCAGTGGGAGGCAGGTAGG - Intronic
1112359961 13:98708532-98708554 GTGGGCAGTGGGAGGCACCATGG - Intronic
1113453804 13:110433038-110433060 GCTGCCAGCGGGAAGCATCTAGG + Intronic
1113576195 13:111396797-111396819 CTGGCCAGTGAGAGGCACCTGGG + Intergenic
1117397456 14:55325031-55325053 GGGGCCTGTGGGAGACAACTGGG - Intronic
1118844465 14:69536501-69536523 GCAGCCAATGGGAAGCCTCTGGG + Intergenic
1121429375 14:93876198-93876220 GTGGCCAGTGGGAGACCTCTAGG + Intergenic
1122270155 14:100565370-100565392 GCAGCCAGTGGGAGGGACCAGGG + Intronic
1122676845 14:103422588-103422610 GAGGCCAAAGGGAGGCTTCTAGG - Intronic
1122993939 14:105252494-105252516 CCGGCCATAGGTAGGCATCTGGG - Exonic
1125069841 15:35540926-35540948 GTGGCCAGGGGGAGGCAACTGGG - Intronic
1128806723 15:70536582-70536604 TCCGCCAGTGAAAGGCATCTGGG - Intergenic
1129490653 15:75922397-75922419 TCTGCCAGTGGGAGGGATCAAGG + Intronic
1135885052 16:26298168-26298190 GGGCCTAGTGGGAGGCATTTGGG - Intergenic
1136620380 16:31424406-31424428 GCGGAACCTGGGAGGCATCTGGG + Intronic
1140847356 16:78903170-78903192 GTGGCCAATGGGAAACATCTAGG - Intronic
1141924531 16:87159218-87159240 GAGGGGAGTGGGAGGCAGCTGGG + Intronic
1143439249 17:6955732-6955754 GGGCCCAGTGGGAGGTATGTGGG + Intronic
1145313941 17:21717634-21717656 GGGCCTAATGGGAGGCATCTGGG + Intergenic
1145885725 17:28381275-28381297 GCGGAGCGTGGCAGGCATCTTGG + Exonic
1146452475 17:32985686-32985708 GCTGCATGTGGGAGTCATCTGGG + Intronic
1151356337 17:73560866-73560888 TCGACCAGTGGGTGGCGTCTGGG + Intronic
1152026876 17:77815675-77815697 GGGGCCAGTGGGAGGCAGGCTGG - Intergenic
1152230725 17:79112820-79112842 GTGGCCTCTGGGTGGCATCTGGG + Intronic
1152335347 17:79697440-79697462 GTGGCCAGGGGGAAGCACCTGGG - Intergenic
1152930985 17:83109760-83109782 GTGGCCAGTGGGAGGCCTGCTGG - Intergenic
1155247013 18:23920213-23920235 GCAGCCTGTAGGAGGCATGTAGG + Intronic
1155726785 18:29096158-29096180 GCTGCAAATTGGAGGCATCTGGG + Intergenic
1159793774 18:72816968-72816990 GCAGCCTGTGGGAGGCATATGGG + Intronic
1161267114 19:3369511-3369533 GCGGGGGGTGGGGGGCATCTCGG + Intronic
1161716804 19:5880784-5880806 GCGGCCAGCGGGTGTCATCAGGG + Intronic
1163151520 19:15417973-15417995 GAGGCCAGTGGGAGGCCAATGGG - Intronic
1163176446 19:15566968-15566990 GGCGCCCGTGGGAGGCATCCAGG - Intergenic
1165340349 19:35207031-35207053 CTGGCTAGTGGAAGGCATCTGGG + Intergenic
1166695246 19:44848111-44848133 GAGGCCAGTGAGAGCCATCCTGG - Intronic
925455647 2:4014453-4014475 GCAGCCTGTGGGAGGCAATTAGG - Intergenic
925917799 2:8619245-8619267 GCTGCCAGTGTGAGCCACCTAGG - Intergenic
927460509 2:23294440-23294462 GCAGCAAGTGGGCGGCACCTGGG - Intergenic
927812563 2:26188014-26188036 GCTGCCAGGAGGAGGCATCTCGG - Exonic
928601789 2:32910519-32910541 GCGGTCAGGAGTAGGCATCTGGG - Intergenic
929538979 2:42805121-42805143 GCTGCCAGTGGGCGGCTTCCCGG - Intergenic
933884387 2:86704520-86704542 GCTGTCACTGGGAGCCATCTGGG - Intronic
935197397 2:100825716-100825738 TGGGCCACTGGGAGGCTTCTGGG + Intronic
937318713 2:120948151-120948173 GCGGCCAGTGAGAGGCAAGCAGG - Intronic
938063279 2:128268131-128268153 GTGGCCACGGGGAGGCCTCTTGG - Exonic
938712091 2:133983730-133983752 GGGGCCAGTGGGAGGTGTTTCGG - Intergenic
940362696 2:152813301-152813323 GCAGCCATTGGCAGGCAGCTGGG + Intergenic
942783427 2:179672600-179672622 GAGGCCTTTGGGAGACATCTGGG + Intronic
945347120 2:208731789-208731811 GCAGCCAGTAGGAAGCACCTTGG + Intronic
948527129 2:238578012-238578034 GGGGCCGGTGGGAGGTGTCTGGG - Intergenic
948834639 2:240620193-240620215 GCAGGCAGTGGGAGCCATCAGGG + Intronic
948853061 2:240717809-240717831 GCGGCCAGTGGAAGGCAGCGCGG - Intronic
948864162 2:240767069-240767091 GAGGCCAGTGGGTGGCGTCCTGG - Intronic
949010794 2:241677272-241677294 GTGGCCAGTGAGAGGCATCTGGG - Intronic
1169751280 20:8997272-8997294 GAGCCCAGTGGGAGGTATTTGGG + Intergenic
1170217253 20:13904638-13904660 ACTGCCAATGGAAGGCATCTGGG + Intronic
1172766234 20:37352549-37352571 GAGGCCAGGGTGAGGCATCGGGG - Intronic
1173209558 20:41021624-41021646 GCAGGCAGTGGGAGGCATAGAGG - Intergenic
1173839415 20:46147685-46147707 GTTGCCAGAGAGAGGCATCTTGG + Intergenic
1173843183 20:46172341-46172363 GTGGCCAGTGGCAGGGATGTGGG - Intergenic
1175448438 20:59042606-59042628 GCGGCCCGCAGGAGGCTTCTAGG - Intronic
1175969301 20:62675790-62675812 GCTGGCTGTGGGAGGCATCCAGG - Intronic
1176336750 21:5606111-5606133 GCGAGCAGTGGGGGTCATCTCGG + Intergenic
1176391007 21:6214837-6214859 GCGAGCAGTGGGGGTCATCTCGG - Intergenic
1176470412 21:7101337-7101359 GCGAGCAGTGGGGGTCATCTCGG + Intergenic
1176493973 21:7483115-7483137 GCGAGCAGTGGGGGTCATCTCGG + Intergenic
1176506669 21:7655268-7655290 GCGAGCAGTGGGGGTCATCTCGG - Intergenic
1178409798 21:32353751-32353773 GAGCACAGTGGGAGGGATCTTGG - Intronic
1179171258 21:38974742-38974764 GTTACCACTGGGAGGCATCTTGG + Intergenic
1179710157 21:43208712-43208734 GCGGACAGTGGGAGGCCCATAGG + Intergenic
1180092699 21:45541276-45541298 GCGGCCAGTGAGATGCAGCCTGG + Intronic
1180758086 22:18177137-18177159 AGTGGCAGTGGGAGGCATCTGGG + Exonic
1180768374 22:18360929-18360951 AGTGGCAGTGGGAGGCATCTGGG + Intergenic
1180777935 22:18501462-18501484 AGTGGCAGTGGGAGGCATCTGGG - Intergenic
1180810659 22:18758773-18758795 AGTGGCAGTGGGAGGCATCTGGG - Intergenic
1180826251 22:18864153-18864175 AGTGGCAGTGGGAGGCATCTGGG + Intergenic
1181196807 22:21193028-21193050 AGTGGCAGTGGGAGGCATCTGGG - Intergenic
1181212721 22:21300096-21300118 AGTGGCAGTGGGAGGCATCTGGG + Intergenic
1181443037 22:22948044-22948066 GGGGCCATTGGGAGGCAACTAGG - Intergenic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1184120423 22:42446285-42446307 GTGGCCTGTGGGAGGGAGCTGGG - Intergenic
1184132131 22:42523182-42523204 GTGGCCTGTGGGAGGGAGCTGGG - Intergenic
1184422587 22:44390516-44390538 GAGGCCAGTGGGAGGTGGCTGGG + Intergenic
1184519801 22:44986746-44986768 CTGGCATGTGGGAGGCATCTGGG - Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1185337853 22:50278733-50278755 GTGGGCAGTGGGAGGAACCTGGG - Intronic
1203229993 22_KI270731v1_random:101817-101839 AGTGGCAGTGGGAGGCATCTGGG + Intergenic
1203276393 22_KI270734v1_random:90059-90081 AGTGGCAGTGGGAGGCATCTGGG + Intergenic
949636406 3:5986177-5986199 GGGGCCACTGGGGGCCATCTTGG + Intergenic
949851489 3:8425147-8425169 GGAGTCACTGGGAGGCATCTTGG + Intergenic
952540942 3:34367075-34367097 GGGGCCAGTTGCAGGCAGCTTGG - Intergenic
954854341 3:53629989-53630011 GAGGCCAGTGAGAGTCATCAGGG - Intronic
956720799 3:72115755-72115777 GGGGCCTCTGGGAGGCAACTGGG - Intergenic
958898790 3:99861308-99861330 GCAGCCAGGGGAAGGCATCATGG - Intronic
961522492 3:127475135-127475157 GGTGCCTGTGGGAGGCATGTTGG + Intergenic
961788166 3:129359891-129359913 CTTGCCAGAGGGAGGCATCTGGG + Intergenic
962712461 3:138099604-138099626 GGGCCCAGTGGGAGGTATCTGGG + Intronic
963687158 3:148450893-148450915 GTGGCCTGTGGGAGGTATCTGGG + Intergenic
964627775 3:158775932-158775954 GTGGCCAGTGGGAAACCTCTAGG - Intronic
966729806 3:183141199-183141221 GGGGCCAGTGGGAGGGATTATGG + Intronic
968486605 4:865991-866013 GAGGTCAGAGGGAGGCAGCTGGG - Intronic
968493942 4:905137-905159 GTGGCCAGTGGGAAACCTCTAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
969576364 4:8038372-8038394 GAGACCACTGGGATGCATCTGGG - Intronic
970176645 4:13346210-13346232 GGGCCCAGTGGGAGGTGTCTGGG + Intergenic
974532220 4:63123658-63123680 GTGGCCAATGGGAAGCCTCTAGG + Intergenic
978824561 4:113005750-113005772 GGGCCTAGTGGGAGGCATTTGGG + Intronic
987124863 5:14802713-14802735 GCAGCCAGGGGGAGGCAGGTGGG - Intronic
987356239 5:17065659-17065681 GGGCCCAGAGGGAGGCAGCTTGG - Intronic
988297378 5:29383043-29383065 GTGGCCAATGGGAGACTTCTAGG + Intergenic
988865552 5:35330794-35330816 GGGCCCAGTGGAAGGTATCTGGG + Intergenic
996662528 5:126021111-126021133 GGGCCCAGTGGGAGGCGTTTGGG + Intergenic
997432602 5:133851165-133851187 TCTGCCAGTGGGAGGGTTCTTGG - Intergenic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998106467 5:139472089-139472111 GGGGACAGTGGGAGGAAACTTGG + Intergenic
1002047934 5:176552516-176552538 GCAGCCAGTGGGAGCCATGGAGG + Intronic
1002257491 5:177968912-177968934 GGGGCTAGTGGGAGGTATTTGGG - Intergenic
1004160082 6:13205326-13205348 GGGCCTAGTGGGAGGCATTTGGG - Intronic
1004476988 6:15982353-15982375 CAGCCCAGTGGGAGGCATTTGGG + Intergenic
1004706216 6:18126196-18126218 GTGGCCAGTGGGAAACCTCTAGG - Intergenic
1004965655 6:20847963-20847985 ATGGCCAGTGGGAAACATCTAGG - Intronic
1007599838 6:43074994-43075016 GCGGCCAGGGCAAGGCAGCTTGG - Exonic
1013076583 6:106777036-106777058 GGGGCCTTTGGGAGGCATTTAGG - Intergenic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1018059335 6:160078474-160078496 GTGGCCACTGGGCAGCATCTTGG + Intronic
1018686197 6:166306988-166307010 GGGGGCAGAGGCAGGCATCTGGG + Exonic
1019404550 7:876839-876861 GCGGCCAATGGGAGGCGGCGGGG - Intronic
1019634805 7:2069844-2069866 GCGGACAGGGAGAGGCCTCTTGG - Intronic
1020093138 7:5352553-5352575 GCTGCCACTGGGAGGCTGCTGGG - Intronic
1023813200 7:43928241-43928263 GGGCCTAGTGGGAGGTATCTGGG - Intronic
1024299141 7:47873149-47873171 GGGGCCGGTGGGAGGAAGCTGGG + Intronic
1025025804 7:55515235-55515257 GTGGGTAGTGGGAGGCCTCTTGG - Intronic
1027172969 7:75885818-75885840 GAGCTCAGTGGGAGGCGTCTGGG - Intronic
1027515445 7:79136917-79136939 GGGACCAATGGGAGGCATCAGGG - Intronic
1033304578 7:140215061-140215083 GAGGACAGTGGGAGGCCACTGGG + Intergenic
1034400380 7:150857900-150857922 GTAGCCAGTGGCATGCATCTTGG - Exonic
1035100162 7:156389708-156389730 GCGGCCAGTGGCTTGCATCTGGG + Intergenic
1035174027 7:157037744-157037766 GAGGGCAGAGGGAGGCAGCTCGG + Intergenic
1039711339 8:40058864-40058886 GCAGCCAGTTGAAGTCATCTTGG + Intergenic
1046712067 8:117521072-117521094 GAGGCCAGGGGGATGCAGCTGGG + Intronic
1048165505 8:132058458-132058480 CCGGCCATTGGGAGACAGCTAGG - Intronic
1048337749 8:133515380-133515402 GGGCCCTGTGGGAGGCATCTGGG + Intronic
1049510615 8:143025008-143025030 GCGGCCAGGCGGGGGCATCGGGG + Intergenic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1051057938 9:13009699-13009721 GAGGCCAGTGGGAGAAATGTAGG + Intergenic
1055678368 9:78689236-78689258 GCGAGCACTGGGAGGCATTTTGG + Intergenic
1056720755 9:89069739-89069761 GCTGCCAGAGGCAGGCATCATGG - Intronic
1057091989 9:92266596-92266618 GAGCCCGATGGGAGGCATCTGGG + Intronic
1057194777 9:93110866-93110888 GGGGCCAGAGGGTGGCCTCTGGG - Intronic
1057587860 9:96345780-96345802 GCAGCCAGTGAGGGGCAGCTGGG + Intronic
1061283405 9:129609791-129609813 AGGGCCAGGGGGAGGCGTCTGGG + Intronic
1061674602 9:132208602-132208624 GCAGGCGGTGGGAGGCATCATGG + Intronic
1062187694 9:135227427-135227449 GGGGCCAGTGGGGGTCAGCTCGG - Intergenic
1062276914 9:135735647-135735669 GAGGCCTGTGGGAGGCAGGTGGG - Intronic
1203424903 Un_GL000195v1:28791-28813 GCGAGCAGTGGGGGTCATCTCGG - Intergenic
1185827015 X:3261203-3261225 GGGGCCTGTGGGAGGTATGTAGG + Intergenic
1186487723 X:9946436-9946458 GAGGCCTGTGGGCGGCTTCTGGG + Intronic
1192057625 X:67788363-67788385 GATGCCAGTGGGAAACATCTTGG + Intergenic
1196858485 X:120005710-120005732 GTGGCCAGTGGGAAACCTCTAGG - Intergenic
1198175590 X:134151365-134151387 GGGGCTAGTGGGAGGTGTCTGGG - Intergenic
1199065475 X:143412109-143412131 GGGCCCAGTGGGAGGTTTCTGGG + Intergenic