ID: 1076064817

View in Genome Browser
Species Human (GRCh38)
Location 10:127440787-127440809
Sequence ACATCCTCGGCCACCCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076064817_1076064825 -4 Left 1076064817 10:127440787-127440809 CCCATGAGGGTGGCCGAGGATGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1076064825 10:127440806-127440828 ATGTCAGACCAGGGGGGCACTGG No data
1076064817_1076064827 3 Left 1076064817 10:127440787-127440809 CCCATGAGGGTGGCCGAGGATGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1076064827 10:127440813-127440835 ACCAGGGGGGCACTGGCTGGAGG No data
1076064817_1076064829 7 Left 1076064817 10:127440787-127440809 CCCATGAGGGTGGCCGAGGATGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1076064829 10:127440817-127440839 GGGGGGCACTGGCTGGAGGCTGG No data
1076064817_1076064826 0 Left 1076064817 10:127440787-127440809 CCCATGAGGGTGGCCGAGGATGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1076064826 10:127440810-127440832 CAGACCAGGGGGGCACTGGCTGG No data
1076064817_1076064824 -10 Left 1076064817 10:127440787-127440809 CCCATGAGGGTGGCCGAGGATGT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1076064824 10:127440800-127440822 CCGAGGATGTCAGACCAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076064817 Original CRISPR ACATCCTCGGCCACCCTCAT GGG (reversed) Intronic
902557619 1:17256265-17256287 ACCTACTTGGCCAACCTCATGGG - Intronic
905346584 1:37315180-37315202 ACAGCCACTGCCACCCTCAAAGG - Intergenic
905995782 1:42380214-42380236 ACATCCTCCCCCACCCCCGTGGG + Intergenic
914765163 1:150630852-150630874 ACATCATGATCCACCCTCATCGG - Intergenic
920497114 1:206462900-206462922 ACATCCACAGCCAGGCTCATGGG + Exonic
1063009945 10:2012096-2012118 ACATCCTCGGCCACTGGCCTGGG - Intergenic
1064090364 10:12378123-12378145 ATTTCCTGGGCCAGCCTCATGGG + Intronic
1068444898 10:57108348-57108370 GCATCCTCTCCCACACTCATAGG - Intergenic
1071198356 10:83188041-83188063 ACATGCTCTGCCACTCTCCTGGG + Intergenic
1073380640 10:103075529-103075551 ACATCCTCGGGCTACCTGATGGG + Intronic
1075573050 10:123559133-123559155 ACCTCCTCTGCCACCCTCTGAGG - Intergenic
1076064817 10:127440787-127440809 ACATCCTCGGCCACCCTCATGGG - Intronic
1077774849 11:5259130-5259152 TCATCCTCTGCCACCTCCATTGG + Intronic
1085349206 11:75787817-75787839 TCATCATCTGCCTCCCTCATTGG - Intronic
1090059418 11:123451062-123451084 CCATTCTCTGCCACCCTGATGGG - Intergenic
1091549846 12:1529443-1529465 ACCTCCTTGGACACCCTCTTGGG + Intergenic
1097008836 12:55938266-55938288 ACATCCTAGGCCGCCTACATGGG - Intronic
1098986160 12:77014722-77014744 CCTTGCTCGGCCCCCCTCATTGG - Intergenic
1100524134 12:95404264-95404286 AGATGCTCGGCTACCCTCACAGG + Intergenic
1102471889 12:113163979-113164001 AGATCCTAGGACAGCCTCATGGG + Intronic
1102765358 12:115428178-115428200 ACAGCCTTGGCCAGCCCCATGGG - Intergenic
1106134021 13:26961062-26961084 ACATGCAGGCCCACCCTCATAGG - Intergenic
1106555679 13:30806294-30806316 TCATCCTCTCCCACCCACATGGG - Intergenic
1107400211 13:40062131-40062153 ACAGCCTCCCCCACCCTCACGGG + Intergenic
1113914275 13:113861600-113861622 GCATCCTCTGCCACACTCTTGGG - Intronic
1116114915 14:40635711-40635733 ACTTCCTTGGCCACCCTGGTTGG - Intergenic
1116876940 14:50121583-50121605 ACACCATCTGCCAACCTCATAGG - Intronic
1116876964 14:50121789-50121811 ACACCATCTGCCAACCTCATAGG - Intronic
1119895140 14:78213745-78213767 ACTTCCATGGCTACCCTCATAGG + Intergenic
1120077191 14:80172393-80172415 ACATCCTCGGCACCACTCATAGG - Intergenic
1134047798 16:11114114-11114136 ACACACACGGCCATCCTCATGGG - Intronic
1142260352 16:89039908-89039930 TCTTCCTCGGGCACCCGCATTGG + Intergenic
1143878787 17:10013937-10013959 AAATCCTGGGCCACCCTCTGTGG + Intronic
1144117257 17:12109680-12109702 TCATCATCATCCACCCTCATTGG - Intronic
1145233359 17:21190980-21191002 ACATCCTGGGCCACCTCCACAGG - Exonic
1145833827 17:27938742-27938764 CCATTCTCAGCCACCCTGATTGG - Intergenic
1148218216 17:45845385-45845407 ACATCCTCAGCCACACTCGTGGG + Exonic
1155078418 18:22383481-22383503 CCTTGCTCCGCCACCCTCATGGG - Intergenic
1159676585 18:71291181-71291203 ACATGCTAGGCCACTCTCAAAGG + Intergenic
1160973360 19:1780196-1780218 ACAGCCTCGGCCTCCCTCCCTGG + Exonic
1163290789 19:16377821-16377843 ACATGCCCGGCCACCCGCACTGG + Intronic
1163313911 19:16530197-16530219 ACATTCTGGGACACGCTCATGGG + Intronic
1163484638 19:17578490-17578512 GCATCCTCATCCACCCTCAGAGG + Intronic
1163588583 19:18177549-18177571 ACATCCCTAGCCACCCCCATTGG + Intronic
1164569781 19:29364908-29364930 ACATCCGTGGCCACCCTCAGTGG - Intergenic
1165034363 19:33022375-33022397 ACCTCCTCTGCCCCCCTCAGCGG + Intronic
1165898453 19:39156809-39156831 ACTTCCTGGGCCACCCTCAATGG - Intronic
1167249519 19:48392782-48392804 ACACCCTCTTCCACCCTCAGAGG + Intergenic
1168301496 19:55407545-55407567 ACACCCCCGACCACCTTCATGGG + Intronic
926714645 2:15914573-15914595 ACAGCCTCCGCCAGTCTCATAGG + Intergenic
937325211 2:120986173-120986195 ACACCCTCGCCCACCCTGAGGGG - Intronic
946148346 2:217747746-217747768 ACCTCCACGGTCACCCTCCTTGG + Intronic
948714817 2:239854227-239854249 GCAGGCTCGGCCACCCTCATGGG - Intergenic
1177026860 21:15931684-15931706 ACATCCCCTGCCAGCCTCAGAGG - Intergenic
1180246034 21:46547955-46547977 ACATCCTTGGCCAGGCACATTGG - Intronic
950124813 3:10504757-10504779 ACTTCCTAGGCCAGCCTCAGTGG - Intronic
952931704 3:38365729-38365751 GCATCCTCAGCCTACCTCATAGG - Exonic
962978804 3:140469537-140469559 CCATCCTGGGTCACCCCCATGGG + Intronic
968514130 4:1009429-1009451 CCATCCTCAGCCAACCCCATGGG - Intergenic
968626737 4:1629257-1629279 ACAGCCTCGGCCTCCCTCTGTGG - Intronic
978092907 4:104739644-104739666 CCATCCGCAGCCACCCTTATTGG - Intergenic
980856890 4:138451337-138451359 CCATCCCCAACCACCCTCATTGG + Intergenic
981803988 4:148691377-148691399 ACAACATCCTCCACCCTCATGGG - Intergenic
995459663 5:112389679-112389701 ACTTCCTCTGCCCCACTCATTGG + Intronic
1000497701 5:162006310-162006332 ACATCTTAGGGCATCCTCATTGG - Intergenic
1001546489 5:172573742-172573764 GCATCCTCGGCCAGCGTGATTGG - Intergenic
1006294467 6:33163917-33163939 ACATCCTGAGTCACCCTGATGGG - Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1012861584 6:104566685-104566707 AAAGCCTCAGCCACTCTCATGGG + Intergenic
1013614627 6:111830406-111830428 ACCTCCTTGGCCACCTTCAGTGG - Intronic
1019257603 7:61988-62010 AGTTCCTCTGCCACCCTCATGGG + Intergenic
1020188846 7:5979118-5979140 ACAACCTCTGCCTCCCTCCTGGG - Intronic
1020294069 7:6745644-6745666 ACAACCTCTGCCTCCCTCCTGGG + Intergenic
1027669656 7:81079879-81079901 ACATCCTCTTCCAGCCTTATGGG - Intergenic
1031489797 7:122372331-122372353 ACTTCTTGGGCCACCATCATTGG - Intronic
1037811717 8:22090314-22090336 ACCTCCTCCCCAACCCTCATGGG + Intronic
1049423130 8:142525574-142525596 ACAGCCTTGGCCAGCCTGATGGG - Intronic
1061121723 9:128647372-128647394 ACTTCCTAGGCCACTCTCAGAGG + Intronic
1061886250 9:133592393-133592415 ACACCCTCGGCCTCCCTCTCAGG - Intergenic
1192314861 X:70043620-70043642 TCCTCGTCTGCCACCCTCATGGG - Exonic
1194757850 X:97758630-97758652 ACAACCTCAGCCTACCTCATGGG - Intergenic
1195916329 X:109939817-109939839 ACAGCCTTGGCCAACCTCACAGG - Intergenic
1197753185 X:129979710-129979732 ACCCCCTGGGCCACCCTCAGTGG - Intergenic
1201945068 Y:19502633-19502655 AGATCCTCGGCCACCTCTATTGG + Intergenic