ID: 1076066751

View in Genome Browser
Species Human (GRCh38)
Location 10:127454491-127454513
Sequence CCCCCTGAAAACTGGTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076066751_1076066756 15 Left 1076066751 10:127454491-127454513 CCCAAGTACCAGTTTTCAGGGGG No data
Right 1076066756 10:127454529-127454551 GCAGACTCATGCTCCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076066751 Original CRISPR CCCCCTGAAAACTGGTACTT GGG (reversed) Intergenic
No off target data available for this crispr