ID: 1076075649

View in Genome Browser
Species Human (GRCh38)
Location 10:127531853-127531875
Sequence CAGAGAGCAAAAGGTTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076075649_1076075652 -9 Left 1076075649 10:127531853-127531875 CCATTCTAACCTTTTGCTCTCTG No data
Right 1076075652 10:127531867-127531889 TGCTCTCTGGAATTTTCCTCAGG No data
1076075649_1076075654 -7 Left 1076075649 10:127531853-127531875 CCATTCTAACCTTTTGCTCTCTG No data
Right 1076075654 10:127531869-127531891 CTCTCTGGAATTTTCCTCAGGGG No data
1076075649_1076075653 -8 Left 1076075649 10:127531853-127531875 CCATTCTAACCTTTTGCTCTCTG No data
Right 1076075653 10:127531868-127531890 GCTCTCTGGAATTTTCCTCAGGG No data
1076075649_1076075656 9 Left 1076075649 10:127531853-127531875 CCATTCTAACCTTTTGCTCTCTG No data
Right 1076075656 10:127531885-127531907 TCAGGGGCAGAGTTGCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076075649 Original CRISPR CAGAGAGCAAAAGGTTAGAA TGG (reversed) Intergenic
No off target data available for this crispr