ID: 1076076716

View in Genome Browser
Species Human (GRCh38)
Location 10:127539072-127539094
Sequence GCAGGAGATATGGGAATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076076716_1076076719 -7 Left 1076076716 10:127539072-127539094 CCTGACATTCCCATATCTCCTGC No data
Right 1076076719 10:127539088-127539110 CTCCTGCTTTTACCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076076716 Original CRISPR GCAGGAGATATGGGAATGTC AGG (reversed) Intergenic
No off target data available for this crispr